WormBase Tree Display for Variation: WBVar00054322
expand all nodes | collapse all nodes | view schema
| WBVar00054322 | Evidence | Paper_evidence | WBPaper00005344 | ||||
|---|---|---|---|---|---|---|---|
| Name | Public_name | cs44 | |||||
| Other_name | R11E3.6a.1:c.241C>T | ||||||
| CE19548:p.Leu81Phe | |||||||
| HGVSg | CHROMOSOME_IV:g.4798875G>A | ||||||
| Sequence_details | SMap | S_parent | Sequence | R11E3 | |||
| Flanking_sequences | ttcaaatattgcaaaatcacaaaggaacag | tcacaataaatagcaaatctccacaagttt | |||||
| Mapping_target | R11E3 | ||||||
| Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00005344 | ||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Laboratory | UP | ||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00001324 | |||||
| Transcript | R11E3.6a.1 (12) | ||||||
| Genetics | Interpolated_map_position | IV | 1.26024 | ||||
| Description | Phenotype | WBPhenotype:0001369 | Paper_evidence | WBPaper00035551 | |||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | EOR-2::GFP did not immunoprecipitate EOR-1(L81F) from staged L4 eor-1(cs44) animals. | Paper_evidence | WBPaper00035551 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Phenotype_not_observed | WBPhenotype:0000112 | Paper_evidence | WBPaper00035551 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | In Western analyses, a polyclonal antibody against EOR-1 equally recognizes a band at the predicted size of EOR-1 (115 kDa) in wild-type animals and in eor-1(cs44) animals. | Paper_evidence | WBPaper00035551 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| WBPhenotype:0000306 | Paper_evidence | WBPaper00035551 | |||||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | Localization of EOR-1::GFP or EOR-1(L81F)::GFP is not affected in these animals. | Paper_evidence | WBPaper00035551 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Reference | WBPaper00005344 | ||||||
| WBPaper00035551 | |||||||
| Method | Substitution_allele |
