WormBase Tree Display for Variation: WBVar00054007
expand all nodes | collapse all nodes | view schema
WBVar00054007 | Evidence | Paper_evidence | WBPaper00032087 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | ce314 | |||||
Other_name | C14F11.3.1:c.651+1G>A | ||||||
HGVSg | CHROMOSOME_X:g.6227185C>T | ||||||
Sequence_details | SMap | S_parent | Sequence | C14F11 | |||
Flanking_sequences | attttctgtgttcttctggattcttatgcg | tattcaacaatagtttttattattacgtaa | |||||
Mapping_target | C14F11 | ||||||
Type_of_mutation | Substitution | g | a | ||||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain (86) | |||||||
Laboratory | KG | ||||||
ZAS | |||||||
OJ | |||||||
EN | |||||||
Status | Live | ||||||
Affects | Gene | WBGene00001803 | |||||
Transcript | C14F11.3.1 | VEP_consequence | splice_donor_variant | ||||
VEP_impact | HIGH | ||||||
HGVSc | C14F11.3.1:c.651+1G>A | ||||||
Intron_number | 7/12 | ||||||
Genetics | Interpolated_map_position | X | -3.37694 | ||||
Description | Phenotype | WBPhenotype:0001787 | Paper_evidence | WBPaper00036207 | |||
Curator_confirmed | WBPerson712 | ||||||
Remark | This lite-1 mutant was isolated in an F1 clonal EMS mutagenesis screen for mutants defective in phototaxis behavior. | Paper_evidence | WBPaper00036207 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0001897 | Paper_evidence | WBPaper00032087 | |||||
Curator_confirmed | WBPerson2021 | ||||||
Remark | lite-1 mutants illuminated with optimal blue-violet light often showed no response to the light. Mutants however become damaged in light and die with a time course that is indistinguishable from wild type | Paper_evidence | WBPaper00032087 | ||||
Curator_confirmed | WBPerson2021 | ||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00032087 | ||||
Curator_confirmed | WBPerson2021 | ||||||
Reference | WBPaper00032087 | ||||||
WBPaper00036207 | |||||||
WBPaper00046411 | |||||||
WBPaper00048388 | |||||||
WBPaper00065310 | |||||||
WBPaper00065804 | |||||||
WBPaper00065754 | |||||||
WBPaper00065757 | |||||||
WBPaper00066013 | |||||||
Method | Substitution_allele |