WormBase Tree Display for Variation: WBVar00000493
expand all nodes | collapse all nodes | view schema
| WBVar00000493 | Evidence | Paper_evidence | WBPaper00003186 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Name | Public_name | bn101 | |||||||
| Other_name | ZK381.4a.1:c.721C>T | ||||||||
| ZK381.4b.1:c.844C>T | |||||||||
| CE25689:p.Gln241Ter | |||||||||
| ZK381.4a.2:c.721C>T | |||||||||
| CE07628:p.Gln282Ter | |||||||||
| HGVSg | CHROMOSOME_IV:g.6976269G>A | ||||||||
| Sequence_details | SMap | S_parent | Sequence | ZK381 | |||||
| Flanking_sequences | tctgttgggaaagttgtgaaccatatcgct | aacttttcgaggaagcgagtaaaaatgaag | |||||||
| Mapping_target | ZK381 | ||||||||
| Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00003186 | ||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Strain | WBStrain00034442 | ||||||||
| WBStrain00034447 | |||||||||
| WBStrain00034454 | |||||||||
| WBStrain00034456 | |||||||||
| WBStrain00040437 | |||||||||
| Laboratory | SS | ||||||||
| Status | Live | ||||||||
| Affects | Gene | WBGene00003992 | |||||||
| Transcript | ZK381.4b.1 | VEP_consequence | stop_gained | ||||||
| VEP_impact | HIGH | ||||||||
| HGVSc | ZK381.4b.1:c.844C>T | ||||||||
| HGVSp | CE07628:p.Gln282Ter | ||||||||
| cDNA_position | 844 | ||||||||
| CDS_position | 844 | ||||||||
| Protein_position | 282 | ||||||||
| Exon_number | 5/9 | ||||||||
| Codon_change | Caa/Taa | ||||||||
| Amino_acid_change | Q/* | ||||||||
| ZK381.4a.2 | VEP_consequence | stop_gained | |||||||
| VEP_impact | HIGH | ||||||||
| HGVSc | ZK381.4a.2:c.721C>T | ||||||||
| HGVSp | CE25689:p.Gln241Ter | ||||||||
| cDNA_position | 775 | ||||||||
| CDS_position | 721 | ||||||||
| Protein_position | 241 | ||||||||
| Exon_number | 6/11 | ||||||||
| Codon_change | Caa/Taa | ||||||||
| Amino_acid_change | Q/* | ||||||||
| ZK381.4a.1 | VEP_consequence | stop_gained | |||||||
| VEP_impact | HIGH | ||||||||
| HGVSc | ZK381.4a.1:c.721C>T | ||||||||
| HGVSp | CE25689:p.Gln241Ter | ||||||||
| cDNA_position | 736 | ||||||||
| CDS_position | 721 | ||||||||
| Protein_position | 241 | ||||||||
| Exon_number | 5/10 | ||||||||
| Codon_change | Caa/Taa | ||||||||
| Amino_acid_change | Q/* | ||||||||
| Interactor | WBInteraction000502232 | ||||||||
| WBInteraction000549004 | |||||||||
| WBInteraction000549006 | |||||||||
| Genetics | Interpolated_map_position | IV | 3.25696 | ||||||
| Description | Phenotype | WBPhenotype:0001036 | Paper_evidence | WBPaper00003186 | |||||
| Curator_confirmed | WBPerson1148 | ||||||||
| Remark | Figure 5 | Paper_evidence | WBPaper00003186 | ||||||
| Curator_confirmed | WBPerson1148 | ||||||||
| Temperature_sensitive | Heat_sensitive | 26 | Paper_evidence | WBPaper00003186 | |||||
| Curator_confirmed | WBPerson1148 | ||||||||
| Phenotype_not_observed | WBPhenotype:0000436 | Paper_evidence | WBPaper00031440 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | MEG-1 localized to P granules in pgl-1 mutants as in wild type | Paper_evidence | WBPaper00031440 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00031440 | ||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Phenotype_assay | Treatment | Antibody staining to MEG-1 | Paper_evidence | WBPaper00031440 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Reference | WBPaper00031440 | ||||||||
| WBPaper00003186 | |||||||||
| Method | Substitution_allele |
