WormBase Tree Display for Variation: WBVar00000483

WBVar00000483 Evidence: Paper_evidence: WBPaper00005301
  Name: Public_name: bn73
    Other_name: CE27781:p.Tyr594Ter
      Y2H9A.1.1:c.1782T>A
    HGVSg: CHROMOSOME_V:g.13434827A>T
  Sequence_details: SMap: S_parent: Sequence: Y2H9A
    Flanking_sequences: cacggttaatcctttgtgcaattccatcat taatggttcgccttgaaaaaaaagagtatt
    Mapping_target: Y2H9A
    Type_of_mutation: Substitution: a t Curator_confirmed: WBPerson4055
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: SS
    Status: Live
  Affects: Gene: WBGene00003222
    Transcript: Y2H9A.1.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: Y2H9A.1.1:c.1782T>A
        HGVSp: CE27781:p.Tyr594Ter
        cDNA_position: 1814
        CDS_position: 1782
        Protein_position: 594
        Exon_number: 8/12
        Codon_change: taT/taA
        Amino_acid_change: Y/*
  Genetics: Interpolated_map_position: V 5.34177
  Description: Phenotype: WBPhenotype:0001504 Paper_evidence: WBPaper00037131
        Curator_confirmed: WBPerson13811
  Reference: WBPaper00005301
    WBPaper00037131
  Remark: Variation flanks and nucleotide change automatically updated to be on the positive strand to fix mapping and gff dumping issues.
    [200224 mh6] reverse complemented/swapped the change and flanks to move the variation onto the plus strand Curator_confirmed: WBPerson4055
  Method: Substitution_allele