WormBase Tree Display for Variation: WBVar00000337
expand all nodes | collapse all nodes | view schema
| WBVar00000337 | Evidence | Paper_evidence | WBPaper00005955 | ||||
|---|---|---|---|---|---|---|---|
| Name | Public_name | ay48 | |||||
| Other_name | Y37D8A.13.1:c.2705C>T | ||||||
| CE20217:p.Pro902Leu | |||||||
| HGVSg | CHROMOSOME_III:g.12881617G>A | ||||||
| Sequence_details | SMap | S_parent | Sequence | Y37D8A | |||
| Flanking_sequences | cgatctttcggttcatggcgatcttcggctc | aatcagtccggcttcttcctcaggccaact | |||||
| Mapping_target | Y37D8A | ||||||
| Type_of_mutation | Substitution | c | t | Curator_confirmed | WBPerson1983 | ||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Laboratory | NH | ||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00006804 | |||||
| Transcript | Y37D8A.13.1 (12) | ||||||
| Genetics | Interpolated_map_position | III | 19.2531 | ||||
| Reference | WBPaper00005955 | ||||||
| Remark | In addition to the curated lesion, ay48 also carries a c -> t substitution resulting in a Q(948)Ochre mutation with flanking sequences of cgatgaatcgccatctccgttctctgatcat & aaagtttcaccactggaattggaatcggag | Curator_confirmed | WBPerson1845 | ||||
| ay48 is a Q(948) to stop mutation | Paper_evidence | WBPaper00005955 | |||||
| [190909 pad] Shifted the substitution 1bp to make the P->L codon change possible. | Curator_confirmed | WBPerson1983 | |||||
| Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00006804 Missense 902 P to L | Paper_evidence | WBPaper00005955 | |||||
| Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00006804 Ochre_UAA Q(948) to stop | Paper_evidence | WBPaper00005955 | |||||
| Method | Substitution_allele |
