WormBase Tree Display for Variation: WBVar00000323
expand all nodes | collapse all nodes | view schema
WBVar00000323 | Evidence | Paper_evidence | WBPaper00005823 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | ax520 | |||||
Other_name | Y110A7A.17a.1:c.1585G>C | ||||||
CE53900:p.Gly531Arg | |||||||
Y110A7A.17b.1:c.1591G>C | |||||||
CE23241:p.Gly529Arg | |||||||
HGVSg | CHROMOSOME_I:g.5125072C>G | ||||||
Sequence_details | SMap | S_parent | Sequence | Y110A7A | |||
Flanking_sequences | ttgcataaacgtagaaagtggaaggttgac | gaaccgagctattgtccacctcaatgtggc | |||||
Mapping_target | Y110A7A | ||||||
Type_of_mutation | Substitution | g | m | Paper_evidence | WBPaper00005823 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Laboratory | JH | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00003132 | |||||
Transcript | Y110A7A.17b.1 (12) | ||||||
Y110A7A.17a.1 (12) | |||||||
Genetics | Interpolated_map_position | I | -0.39766 | ||||
Reference | WBPaper00005823 | ||||||
Remark | Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00003132 Missense 529 G to R | Paper_evidence | WBPaper00005823 | ||||
Method | Substitution_allele |