WormBase Tree Display for Variation: WBVar00000258
expand all nodes | collapse all nodes | view schema
WBVar00000258 | Evidence | Paper_evidence | WBPaper00029172 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | ar492 | ||||||
Other_name (16) | ||||||||
HGVSg | CHROMOSOME_IV:g.3117807A>C | |||||||
Sequence_details | SMap | S_parent | Sequence | Y67D8C | ||||
Flanking_sequences | taatacattcgtcatgatgaccctcttcaa | gagatcaacgctcgtaagattcacggagaa | ||||||
Mapping_target | Y67D8C | |||||||
Type_of_mutation | Substitution | t | g | Paper_evidence | WBPaper00029172 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00008044 | |||||||
Laboratory | GS | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00305860 | ||||||
WBGene00305861 | ||||||||
WBGene00003153 | ||||||||
WBGene00305862 | ||||||||
Transcript (14) | ||||||||
Interactor | WBInteraction000502834 | |||||||
WBInteraction000502835 | ||||||||
Genetics | Interpolated_map_position | IV | -5.83477 | |||||
Description | Phenotype | WBPhenotype:0000315 | Paper_evidence | WBPaper00046308 | ||||
Curator_confirmed | WBPerson10425 | |||||||
WBPhenotype:0000643 | Paper_evidence | WBPaper00004883 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals moved very slowly and had a tendency to curl. | Paper_evidence | WBPaper00004883 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Genotype | dpy-20(e1282); arIs37[pmyo-3::ssGFP] | Paper_evidence | WBPaper00004883 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000644 | Paper_evidence | WBPaper00029172 | ||||||
Curator_confirmed | WBPerson557 | |||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00029172 | |||||
Curator_confirmed | WBPerson557 | |||||||
WBPhenotype:0001426 | Paper_evidence | WBPaper00004883 | ||||||
WBPaper00029172 | ||||||||
Curator_confirmed | WBPerson712 | |||||||
WBPerson557 | ||||||||
Remark | Animals exhibited an accumulation of GFP in the pseudocoelom, rather than being taken up and degraded by coelomocytes as occurred in control animals. | Paper_evidence | WBPaper00004883 | |||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00029172 | |||||
Curator_confirmed | WBPerson557 | |||||||
Phenotype_assay | Genotype | dpy-20(e1282); arIs37[pmyo-3::ssGFP] | Paper_evidence | WBPaper00004883 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001762 | Paper_evidence | WBPaper00004883 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Oocytes did not take up as much yolk as observed for oocytes in control animals, rather yolk granules accumulated in the pseudocoelom. | Paper_evidence | WBPaper00004883 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Genotype | dpy-20(e1282); arIs37[pmyo-3::ssGFP] | Paper_evidence | WBPaper00004883 | ||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00004883 | |||||||
WBPaper00029172 | ||||||||
WBPaper00046308 | ||||||||
WBPaper00061172 | ||||||||
Remark | Variation stub/paper connection generated from the May 2021 NN VFP dataset. | |||||||
Created by WBPerson51134 from the NN_VFP_triage_pipeline | ||||||||
Method | Substitution_allele |