WormBase Tree Display for Variation: WBVar00000229
expand all nodes | collapse all nodes | view schema
| WBVar00000229 | Evidence | Person_evidence | WBPerson292 | ||||
|---|---|---|---|---|---|---|---|
| Name | Public_name | ar200 | |||||
| Other_name | D1014.8.1:c.1263-1G>A | ||||||
| HGVSg | CHROMOSOME_V:g.8127406C>T | ||||||
| Sequence_details | SMap | S_parent | Sequence | D1014 | |||
| Flanking_sequences | taaaaagacagtttgtatggaagagattgagtaagtttgtttatgataattgtattattcttattaaccagtctacttttca | agttctggctgatgattctcgtcgtaaaatgtttgaagcttgtcagcatgggagtaaagtggacattaaattagttgca | |||||
| Mapping_target | D1014 | ||||||
| Type_of_mutation | Substitution | g | a | ||||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Strain | WBStrain00008051 | ||||||
| Laboratory | GS | ||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00005006 | |||||
| Transcript | D1014.8.1 | VEP_consequence | splice_acceptor_variant | ||||
| VEP_impact | HIGH | ||||||
| HGVSc | D1014.8.1:c.1263-1G>A | ||||||
| Intron_number | 9/12 | ||||||
| Interactor | WBInteraction000052173 | ||||||
| Isolation | Mutagen | EMS | |||||
| Forward_genetics | screen for suppressors of the egg-laying defects of sel-12(ar171) | ||||||
| Genetics | Interpolated_map_position | V | 1.01687 | ||||
| Description | Phenotype_not_observed | WBPhenotype:0000886 | Paper_evidence | WBPaper00004474 | |||
| Person_evidence | WBPerson292 | ||||||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | no apparent phenotype on its own. spr-1(ar200) is a strong suppressor of the egg-laying phenotype of sel-12 mutants | Paper_evidence | WBPaper00004474 | ||||
| Person_evidence | WBPerson292 | ||||||
| Curator_confirmed | WBPerson712 | ||||||
| Semi_dominant | Paper_evidence | WBPaper00004474 | |||||
| Person_evidence | WBPerson292 | ||||||
| Curator_confirmed | WBPerson712 | ||||||
| Variation_effect | Loss_of_function_undetermined_extent | Paper_evidence | WBPaper00004474 | ||||
| Person_evidence | WBPerson292 | ||||||
| Curator_confirmed | WBPerson712 | ||||||
| Reference | WBPaper00004474 | ||||||
| Method | Substitution_allele |
