WormBase Tree Display for Variation: WBVar00000105
expand all nodes | collapse all nodes | view schema
WBVar00000105 | Evidence | Paper_evidence | WBPaper00005370 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | ag3 | ||||||
Other_name | CE44901:p.Gln1003Ter | |||||||
F59A6.1a.1:c.3007C>T | ||||||||
F59A6.1b.1:c.2956C>T | ||||||||
CE50862:p.Gln986Ter | ||||||||
HGVSg | CHROMOSOME_II:g.5027769C>T | |||||||
Sequence_details | SMap | S_parent | Sequence | F33G12 | ||||
Flanking_sequences | cttactgctggattctctcatgttcacagt | aaactgtatcgaatgcattgtcaactgcac | ||||||
Mapping_target | F33G12 | |||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00005370 | |||
Person_evidence | WBPerson2292 | |||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00000259 | |||||||
WBStrain00055931 | ||||||||
Laboratory | AU | |||||||
JN | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00003822 | ||||||
Transcript | F59A6.1a.1 | VEP_consequence | stop_gained | |||||
VEP_impact | HIGH | |||||||
HGVSc | F59A6.1a.1:c.3007C>T | |||||||
HGVSp | CE44901:p.Gln1003Ter | |||||||
cDNA_position | 3164 | |||||||
CDS_position | 3007 | |||||||
Protein_position | 1003 | |||||||
Exon_number | 9/12 | |||||||
Codon_change | Caa/Taa | |||||||
Amino_acid_change | Q/* | |||||||
F59A6.1b.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | |||||||
HGVSc | F59A6.1b.1:c.2956C>T | |||||||
HGVSp | CE50862:p.Gln986Ter | |||||||
cDNA_position | 2956 | |||||||
CDS_position | 2956 | |||||||
Protein_position | 986 | |||||||
Exon_number | 8/11 | |||||||
Codon_change | Caa/Taa | |||||||
Amino_acid_change | Q/* | |||||||
Genetics | Interpolated_map_position | II | -2.59195 | |||||
Description | Phenotype | WBPhenotype:0000006 | Paper_evidence | WBPaper00005370 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000386 | Paper_evidence | WBPaper00033433 | ||||||
WBPaper00035318 | ||||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | Copper-induced germ cell apoptosis was abolished in nsy-1(ag3) mutants (Figure 5A). | Paper_evidence | WBPaper00033433 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Cobalt did not induce increased germ cell apoptosis in nsy-1(ag3) mutants, as opposed to wild type animals (Table 2) | Paper_evidence | WBPaper00035318 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Affected_by | Molecule | WBMol:00002862 | Paper_evidence | WBPaper00033433 | ||||
Curator_confirmed | WBPerson2987 | |||||||
WBMol:00003058 | Paper_evidence | WBPaper00035318 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Treatment | Worms were exposed to 10 micromolar of copper for 12 hours | Paper_evidence | WBPaper00033433 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Synchronized young adult hermaphrodites were treated in K-medium with 0.01 millimolar Cobalt chloride for 12 hours, and apoptotic cells were scored after AO staining. | Paper_evidence | WBPaper00035318 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0001012 | Paper_evidence | WBPaper00055320 | ||||||
Curator_confirmed | WBPerson557 | |||||||
Remark | This mutant showed no protection from enterotoxigenic Escherichia coli (ETEC) infection when pretreated with Lactobacillus zeae LB1. Authors show that wild type worms had "enhancement in the resistance" to infection by ETEC when worms were first grown on Lactobacillus zeae LB1. This "enhancement in resistance" is not observed in this mutant. | Paper_evidence | WBPaper00055320 | |||||
Curator_confirmed | WBPerson557 | |||||||
Phenotype_assay | Treatment | Animals were grown on plates containing K88plus enterotoxigenic Escherichia coli(ETEC) strain JG280 after pretreatment with Lactobacillus zeae LB1. | Paper_evidence | WBPaper00055320 | ||||
Curator_confirmed | WBPerson557 | |||||||
WBPhenotype:0001013 | Paper_evidence | WBPaper00005370 | ||||||
WBPaper00055320 | ||||||||
WBPaper00061439 | ||||||||
Curator_confirmed | WBPerson712 | |||||||
WBPerson557 | ||||||||
WBPerson49407 | ||||||||
Remark | When exposed to Pseudomonas aeruginosa strain, PA14, under standard assay conditions, 80% esp-8 animals were killed by 31 hours, compared with 0% wild-type animals. Accumulation of GFP-labeled PA14 was detected as early as 6 hours after exposure. Animals were also hypersusceptible to Enterococcus faecalis. | Paper_evidence | WBPaper00005370 | |||||
Curator_confirmed | WBPerson712 | |||||||
This mutant is more susceptible to enterotoxigenic Escherichia coli infection compared with N2 wild-type animals. | Paper_evidence | WBPaper00055320 | ||||||
Curator_confirmed | WBPerson557 | |||||||
Phenotype_assay | Treatment | Approximately 25 L4-stage worms were placed on each of three agar plates with PA14 lawns under standard slow killing (SK) assay conditions. Survival was assayed after 30 hours. | Paper_evidence | WBPaper00005370 | ||||
Curator_confirmed | WBPerson712 | |||||||
Animals grown on plates containing K88plus enterotoxigenic Escherichia coli (ETEC) strain JG280. | Paper_evidence | WBPaper00055320 | ||||||
Curator_confirmed | WBPerson557 | |||||||
WBPhenotype:0001351 | Paper_evidence | WBPaper00005370 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals had diminished levels of p38 MAP kinase activation compared to wild-type N2 worms, when in the presence of PA14, as determined by immunoblot analysis of lysates from mutants probed with anti-phospho-p38 and anti-PMK-1 with anti-beta-tubulin as a loading control. | Paper_evidence | WBPaper00005370 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | Synchronized L4 populations of N2 wild type, esp-2/sek-1(ag1), and esp-8/nsy-1(ag3) worms were transferred to PA14 plates in parallel, and lysates were prepared for immunoblotting after 6 hours when the worms were predominantly young adults. | Paper_evidence | WBPaper00005370 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001381 | Paper_evidence | WBPaper00037959 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Mutant animals showed higher survival rates under anoxic conditions than the wild-type allele. | Paper_evidence | WBPaper00037959 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001687 | Paper_evidence | WBPaper00056945 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | nsy-1(ag3) animals showed staining of L2-L4 stages. mAb M37 stains only the L1 stage in wild type C. elegans under normal growth conditions. | Paper_evidence | WBPaper00056945 | |||||
Curator_confirmed | WBPerson712 | |||||||
Image | WBPicture0000014905 | Paper_evidence | WBPaper00056945 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001857 | Paper_evidence | WBPaper00035315 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | No induction of Ptph-1::GFP expression by PA14 in the nsy-1 mutant background | Paper_evidence | WBPaper00035315 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Phenotype_not_observed | WBPhenotype:0000039 | Paper_evidence | WBPaper00005370 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Longevity of animals was equivalent to wild-type worms. | Paper_evidence | WBPaper00005370 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | 25 L4 animals were placed on each of three plates that contained 5-fluoro- 2-deoxyuridine and had been seeded with E. coli OP50. | Paper_evidence | WBPaper00005370 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000650 | Paper_evidence | WBPaper00005370 | ||||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000659 | Paper_evidence | WBPaper00005370 | ||||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000676 | Paper_evidence | WBPaper00005370 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | When grown on E. coli OP50 animals develop at a normal rate and reach adulthood concomitant with N2 wild-type worms. | Paper_evidence | WBPaper00005370 | |||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00037959 | |||||||
WBPaper00033433 | ||||||||
WBPaper00005370 | ||||||||
WBPaper00035315 | ||||||||
WBPaper00035318 | ||||||||
WBPaper00055320 | ||||||||
WBPaper00056945 | ||||||||
WBPaper00061439 | ||||||||
WBPaper00065298 | ||||||||
WBPaper00066032 | ||||||||
Method | Substitution_allele |