WormBase Tree Display for Variation: WBVar00000091
expand all nodes | collapse all nodes | view schema
WBVar00000091 | Evidence | Paper_evidence | WBPaper00003954 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | ad1302 | |||||
Other_name | ad1032 | Paper_evidence | WBPaper00027150 | ||||
CE32092:p.Val60Glu | |||||||
CE26421:p.Val60Glu | |||||||
CE30227:p.Val60Glu | |||||||
B0207.12a.1:c.179T>A | |||||||
B0207.12b.1:c.179T>A | |||||||
B0207.12c.1:c.179T>A | |||||||
B0207.12a.2:c.179T>A | |||||||
B0207.12a.3:c.179T>A | |||||||
HGVSg | CHROMOSOME_I:g.5972722A>T | ||||||
Sequence_details | SMap | S_parent | Sequence | B0207 | |||
Flanking_sequences | gatattgatcgaagataaatgtttactgtc | ctagaacgggtccaccggtatctgatagtt | |||||
Mapping_target | B0207 | ||||||
Type_of_mutation | Substitution | a | t | Curator_confirmed | WBPerson4055 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain (16) | |||||||
Laboratory | DA | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00000232 | |||||
Transcript | B0207.12a.2 (12) | ||||||
B0207.12a.3 (12) | |||||||
B0207.12b.1 (12) | |||||||
B0207.12a.1 (12) | |||||||
B0207.12c.1 (12) | |||||||
Interactor | WBInteraction000500425 | ||||||
WBInteraction000557980 | |||||||
WBInteraction000557982 | |||||||
Genetics | Interpolated_map_position | I | 0.512537 | ||||
Description | Phenotype (5) | ||||||
Reference | WBPaper00025420 | ||||||
WBPaper00032335 | |||||||
WBPaper00003954 | |||||||
WBPaper00010338 | |||||||
Remark | Allele incorrectly cited as ad1032 | Paper_evidence | WBPaper00027150 | ||||
Variation flanks and nucleotide change automatically updated to be on the positive strand to fix mapping and gff dumping issues. | |||||||
[200224 mh6] reverse complemented/swapped the change and flanks to move the variation onto the plus strand | Curator_confirmed | WBPerson4055 | |||||
Method | Substitution_allele |