WormBase Tree Display for Variation: WBVar00000091
expand all nodes | collapse all nodes | view schema
WBVar00000091 | Evidence | Paper_evidence | WBPaper00003954 | |||||
---|---|---|---|---|---|---|---|---|
Name (3) | ||||||||
Sequence_details | SMap | S_parent | Sequence | B0207 | ||||
Flanking_sequences | gatattgatcgaagataaatgtttactgtc | ctagaacgggtccaccggtatctgatagtt | ||||||
Mapping_target | B0207 | |||||||
Type_of_mutation | Substitution | a | t | Curator_confirmed | WBPerson4055 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain (16) | ||||||||
Laboratory | DA | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00000232 | ||||||
Transcript | B0207.12a.2 (12) | |||||||
B0207.12a.3 (12) | ||||||||
B0207.12b.1 (12) | ||||||||
B0207.12a.1 (12) | ||||||||
B0207.12c.1 (12) | ||||||||
Interactor | WBInteraction000500425 | |||||||
WBInteraction000557980 | ||||||||
WBInteraction000557982 | ||||||||
Genetics | Interpolated_map_position | I | 0.512537 | |||||
Description | Phenotype | WBPhenotype:0001444 | Paper_evidence | WBPaper00032335 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals exhibited defective gustatory plasticity of NaCl. | Paper_evidence | WBPaper00032335 | |||||
Curator_confirmed | WBPerson712 | |||||||
Affected_by | Molecule | WBMol:00003571 | Paper_evidence | WBPaper00032335 | ||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | Animals were tested for response to 25 mM NaCl after various pre-treatments: a 15-min wash in CTX buffer with or without 100 mM NaCl (liquid), or 30 min on a CTX plate with or without 100 mM NaCl, and in the presence or absence of bacteria, 500 mM glycerol, or 3 uL of benzaldehyde. | Paper_evidence | WBPaper00032335 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001453 | Paper_evidence | WBPaper00032335 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals showed stronger avoidance of 1 M NaCl compared to wild type. | Paper_evidence | WBPaper00032335 | |||||
Curator_confirmed | WBPerson712 | |||||||
Affected_by | Molecule | WBMol:00003571 | Paper_evidence | WBPaper00032335 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001462 | Paper_evidence | WBPaper00032335 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals showed defects in chemotaxis to NaCl compared to wild type. | Paper_evidence | WBPaper00032335 | |||||
Curator_confirmed | WBPerson712 | |||||||
Affected_by | Molecule | WBMol:00003571 | Paper_evidence | WBPaper00032335 | ||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | Animals were tested for response to 25 mM NaCl. | Paper_evidence | WBPaper00032335 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001817 | Paper_evidence | WBPaper00032335 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals exhibited significant reduced starvation-enhanced gustatory plasticity compared to wild type. | Paper_evidence | WBPaper00032335 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0002053 | Paper_evidence | WBPaper00003954 | ||||||
Curator_confirmed | WBPerson134 | |||||||
Remark | synthetic resistance with avr-15(ad1051) | Paper_evidence | WBPaper00003954 | |||||
Curator_confirmed | WBPerson134 | |||||||
synthetic resistance with glc-1(pk54) | Paper_evidence | WBPaper00003954 | ||||||
Curator_confirmed | WBPerson134 | |||||||
Affected_by | Molecule | WBMol:00002786 | Paper_evidence | WBPaper00003954 | ||||
Curator_confirmed | WBPerson134 | |||||||
Phenotype_assay | Genotype | avr-15(ad1051) | Paper_evidence | WBPaper00003954 | ||||
Curator_confirmed | WBPerson134 | |||||||
glc-1(pk54) | Paper_evidence | WBPaper00003954 | ||||||
Curator_confirmed | WBPerson134 | |||||||
Reference | WBPaper00025420 | |||||||
WBPaper00032335 | ||||||||
WBPaper00003954 | ||||||||
WBPaper00010338 | ||||||||
Remark | Allele incorrectly cited as ad1032 | Paper_evidence | WBPaper00027150 | |||||
Variation flanks and nucleotide change automatically updated to be on the positive strand to fix mapping and gff dumping issues. | ||||||||
[200224 mh6] reverse complemented/swapped the change and flanks to move the variation onto the plus strand | Curator_confirmed | WBPerson4055 | ||||||
Method | Substitution_allele |