WormBase Tree Display for Variation: WBVar00000071
expand all nodes | collapse all nodes | view schema
WBVar00000071 | Evidence | Paper_evidence | WBPaper00006439 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | ad820 | |||||
Other_name | ad820sd | ||||||
Y105E8A.7b.1:c.77-1140G>A | |||||||
Y105E8A.7e.1:c.77-1140G>A | |||||||
CE33723:p.Gly60Glu | |||||||
Y105E8A.7a.1:c.77-1140G>A | |||||||
CE37055:p.Gly60Glu | |||||||
Y105E8A.7d.2:c.179G>A | |||||||
Y105E8A.7d.1:c.179G>A | |||||||
Y105E8A.7c.1:c.179G>A | |||||||
Y105E8A.7d.3:c.179G>A | |||||||
HGVSg | CHROMOSOME_I:g.14392185G>A | ||||||
Sequence_details | SMap | S_parent | Sequence | Y105E8A | |||
Flanking_sequences | tagttttgattatggtgttctggctgaaag | ggtcctgcagtatgaggagtgagtttttgg | |||||
Mapping_target | Y105E8A | ||||||
Type_of_mutation | Substitution | g | a | ||||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00005519 | ||||||
WBStrain00005540 | |||||||
Laboratory | DA | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00001147 | |||||
WBGene00002977 | |||||||
Transcript | Y105E8A.7e.1 | VEP_consequence | intron_variant | ||||
VEP_impact | MODIFIER | ||||||
HGVSc | Y105E8A.7e.1:c.77-1140G>A | ||||||
Intron_number | 1/7 | ||||||
Y105E8A.7d.1 (12) | |||||||
Y105E8A.7b.1 | VEP_consequence | intron_variant | |||||
VEP_impact | MODIFIER | ||||||
HGVSc | Y105E8A.7b.1:c.77-1140G>A | ||||||
Intron_number | 2/15 | ||||||
Y105E8A.7d.3 | VEP_consequence | missense_variant | |||||
VEP_impact | MODERATE | ||||||
SIFT | 0.19 | tolerated_low_confidence | |||||
PolyPhen | 0.999 | probably_damaging | |||||
HGVSc | Y105E8A.7d.3:c.179G>A | ||||||
HGVSp | CE37055:p.Gly60Glu | ||||||
cDNA_position | 216 | ||||||
CDS_position | 179 | ||||||
Protein_position | 60 | ||||||
Exon_number | 2/15 | ||||||
Codon_change | gGg/gAg | ||||||
Amino_acid_change | G/E | ||||||
Y105E8A.7d.2 (12) | |||||||
Y105E8A.7c.1 (12) | |||||||
Y105E8A.7a.1 | VEP_consequence | intron_variant | |||||
VEP_impact | MODIFIER | ||||||
HGVSc | Y105E8A.7a.1:c.77-1140G>A | ||||||
Intron_number | 2/14 | ||||||
Genetics | Interpolated_map_position | I | 24.681 | ||||
Mapping_data | In_2_point | 7014 | |||||
In_multi_point | 3094 | ||||||
3095 | |||||||
In_pos_neg_data | 8331 | ||||||
8332 | |||||||
8333 | |||||||
8334 | |||||||
8335 | |||||||
8336 | |||||||
Description | Phenotype | WBPhenotype:0000402 | Paper_evidence | WBPaper00056338 | |||
Curator_confirmed | WBPerson36360 | ||||||
WBPhenotype:0002056 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | Eat; homozygote has slow pharyngeal pumping, lacks I-phase transients in the EPG, and is starved. Easy to score (ES3). ad820/+ pumps slower than wild type but faster than ad820/ad820 and is not very starved, which is very hard to score (ES1). | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||
Semi_dominant | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||
Ease_of_scoring | ES3_Easy_to_score | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0002159 | Paper_evidence | WBPaper00056338 | |||||
Curator_confirmed | WBPerson36360 | ||||||
Reference | WBPaper00018319 | ||||||
WBPaper00002341 | |||||||
WBPaper00022005 | |||||||
WBPaper00056338 | |||||||
Remark | Added the references from WBVar00000072 as it seems there was a data integration issue. | ||||||
Method | Substitution_allele |