WormBase Tree Display for Variation: WBVar00000049
expand all nodes | collapse all nodes | view schema
| WBVar00000049 | Evidence | Paper_evidence | WBPaper00027615 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Name | Public_name | ad695 | |||||||
| Other_name | ad695sd | ||||||||
| CE31165:p.Ala906Val | |||||||||
| C48A7.1b.1:c.2717C>T | |||||||||
| CE28820:p.Ala906Val | |||||||||
| C48A7.1a.1:c.2717C>T | |||||||||
| HGVSg | CHROMOSOME_IV:g.7411583C>T | ||||||||
| Sequence_details | SMap | S_parent | Sequence | C48A7 | |||||
| Flanking_sequences | gtgtgctccgtgtgctccgtccacttcgtg | aattaaccgagccaagggtttgaaacatgt | |||||||
| Mapping_target | C48A7 | ||||||||
| Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00027615 | ||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Strain | WBStrain00005503 | ||||||||
| WBStrain00005514 | |||||||||
| WBStrain00005524 | |||||||||
| WBStrain00005536 | |||||||||
| WBStrain00023532 | |||||||||
| WBStrain00024343 | |||||||||
| Laboratory | DA | ||||||||
| Status | Live | ||||||||
| Affects | Gene | WBGene00001187 | |||||||
| Transcript | C48A7.1a.1 (12) | ||||||||
| C48A7.1b.1 (12) | |||||||||
| Genetics | Interpolated_map_position | IV | 3.3345 | ||||||
| Mapping_data | In_multi_point | 1922 | |||||||
| 1924 | |||||||||
| 1926 | |||||||||
| 1927 | |||||||||
| 1928 | |||||||||
| 1929 | |||||||||
| 2400 | |||||||||
| 2464 | |||||||||
| 2465 | |||||||||
| 3032 | |||||||||
| Description | Phenotype (13) | ||||||||
| Phenotype_not_observed | WBPhenotype:0001101 | Paper_evidence | WBPaper00031871 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | Animals retained more eggs after treatment with dihydropyridine (DHP) analog nemadipine, compared to control animals treated with DMSO alone. | Paper_evidence | WBPaper00031871 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00031871 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Affected_by | Molecule | WBMol:00001631 | Paper_evidence | WBPaper00031871 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| EQ_annotations | GO_term | GO:0018991 | PATO:0000460 | Paper_evidence | WBPaper00031871 | ||||
| Curator_confirmed | WBPerson712 | ||||||||
| Phenotype_assay | Treatment | 5uM nemadipine in DMSO or DMSO alone | Paper_evidence | WBPaper00031871 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0001645 | Paper_evidence | WBPaper00040284 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | Table S2 | Paper_evidence | WBPaper00040284 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBPhenotype:0001660 | Paper_evidence | WBPaper00006052 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | No disruption of ASE asymmetry (as seen with lim-6 reporters) | Paper_evidence | WBPaper00006052 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Phenotype_assay | Genotype | otIs114, otIs6 | Paper_evidence | WBPaper00006052 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Reference (12) | |||||||||
| Method | Substitution_allele |
