WormBase Tree Display for Variation: WBVar00000049
expand all nodes | collapse all nodes | view schema
WBVar00000049 | Evidence | Paper_evidence | WBPaper00027615 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | ad695 | |||||||
Other_name | ad695sd | ||||||||
CE31165:p.Ala906Val | |||||||||
C48A7.1b.1:c.2717C>T | |||||||||
CE28820:p.Ala906Val | |||||||||
C48A7.1a.1:c.2717C>T | |||||||||
HGVSg | CHROMOSOME_IV:g.7411583C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | C48A7 | |||||
Flanking_sequences | gtgtgctccgtgtgctccgtccacttcgtg | aattaaccgagccaagggtttgaaacatgt | |||||||
Mapping_target | C48A7 | ||||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00027615 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00005503 | ||||||||
WBStrain00005514 | |||||||||
WBStrain00005524 | |||||||||
WBStrain00005536 | |||||||||
WBStrain00023532 | |||||||||
WBStrain00024343 | |||||||||
Laboratory | DA | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00001187 | |||||||
Transcript | C48A7.1a.1 (12) | ||||||||
C48A7.1b.1 (12) | |||||||||
Genetics (2) | |||||||||
Description | Phenotype (13) | ||||||||
Phenotype_not_observed | WBPhenotype:0001101 | Paper_evidence | WBPaper00031871 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals retained more eggs after treatment with dihydropyridine (DHP) analog nemadipine, compared to control animals treated with DMSO alone. | Paper_evidence | WBPaper00031871 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00031871 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00001631 | Paper_evidence | WBPaper00031871 | |||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | GO_term | GO:0018991 | PATO:0000460 | Paper_evidence | WBPaper00031871 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | 5uM nemadipine in DMSO or DMSO alone | Paper_evidence | WBPaper00031871 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001645 | Paper_evidence | WBPaper00040284 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Table S2 | Paper_evidence | WBPaper00040284 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001660 | Paper_evidence | WBPaper00006052 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | No disruption of ASE asymmetry (as seen with lim-6 reporters) | Paper_evidence | WBPaper00006052 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | otIs114, otIs6 | Paper_evidence | WBPaper00006052 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference (12) | |||||||||
Method | Substitution_allele |