WormBase Tree Display for Transgene: WBTransgene00005183
expand all nodes | collapse all nodes | view schema
| WBTransgene00005183 | Public_name | zcIs13 | |||
|---|---|---|---|---|---|
| Summary | [Phsp-6::GFP] | ||||
| Synonym | Expr3096_Ex | ||||
| [hsp-6::gfp; lin-15(+)] | |||||
| mtHSP70 | |||||
| Construction | Construct | WBCnstr00005160 | |||
| Coinjection_other | pSK1[lin-15(+)] | ||||
| Integration_method | UV_TMP | ||||
| Construction_summary | hsp-6::gfp was constructed by ligating a 1.7 kb HindIII- BamHI PCR fragment derived by amplification of C. elegans genomic DNA with the primers: C37H5.5.2AS (TCGAGTCCATA- CAAGCACTC) and C37H5.8.2AS (GGGGGGATCCGAAGACAAGAATGATCGTGC) into the GFP reporter plasmid pPD95.75 (a gift of Andy Fire, Baltimore MD, USA). hsp-6::gfp contains the 5' flanking region and encodes the predicted first 10 amino acids of HSP-6 fused to GFP. | ||||
| Genetic_information | Integrated | ||||
| Map | V | ||||
| Used_for | Expr_pattern | Expr13432 | |||
| Marker_for | UPR(mt) | Paper_evidence | WBPaper00053213 | ||
| mitochondrial stress | Paper_evidence | WBPaper00053213 | |||
| Interactor (306) | |||||
| Associated_with | Strain | WBStrain00007695 | |||
| WBStrain00007696 | |||||
| WBStrain00007697 | |||||
| WBStrain00007698 | |||||
| WBStrain00007699 | |||||
| WBStrain00034068 | |||||
| WBStrain00049994 | |||||
| Reference (139) | |||||
| Species | Caenorhabditis elegans |
