hsp-6::gfp was constructed by ligating a 1.7 kb HindIII- BamHI PCR fragment derived by amplification of C. elegans genomic DNA with the primers: C37H5.5.2AS (TCGAGTCCATA- CAAGCACTC) and C37H5.8.2AS (GGGGGGATCCGAAGACAAGAATGATCGTGC) into the GFP reporter plasmid pPD95.75 (a gift of Andy Fire, Baltimore MD, USA). hsp-6::gfp contains the 5' flanking region and encodes the predicted first 10 amino acids of HSP-6 fused to GFP.