WormBase Tree Display for Strain: WBStrain00055459
expand all nodes | collapse all nodes | view schema
| WBStrain00055459 | Genotype | fars-2(ve811[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/sC4(s2172) [dpy-21(e428)] V. | ||
|---|---|---|---|---|
| Public_name | RG3311 | |||
| Contains | Gene | WBGene00001080 | ||
| WBGene00003514 | ||||
| WBGene00004496 | ||||
| WBGene00006789 | ||||
| WBGene00013361 | ||||
| Variation | WBVar00143205 | |||
| Rearrangement | sC4 | |||
| Properties | Outcrossed | x0 | ||
| Mutagen | CRISPR_Cas9 | |||
| CGC_received | 14 Nov 2022 00:00:00 | |||
| Location | CGC | |||
| Remark | Homozygous Ste, Pvl, Unc. Deletion of 3213 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type dim GFP+, and segregate wild-type dim GFP+, bright GFP+ Ste, Pvl, and Unc animals (ve811 homozygotes) and arrested non-GFP (stage unknown, some uncharacterized non-GFP hermaphrodites develop into fertile adults) (sC4 homozygotes). Maintain by picking wild-type dim GFP+.Left flanking Sequence: ggtttttcagtgctcttcgtattacCTCCT ; Right flanking sequence: TTCGTCTTTCGAGTAGAGCCGAACACCTTC. sgRNA #3: TGAAAGAGCACTTACCAAGG; sgRNA #4: CTACTCGGCAAAAAGCCGGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. | Inferred_automatically | From CGC strain data | |
| Made_by: RG KO Group | CGC_data_submission | |||
| Species | Caenorhabditis elegans |
