WormBase Tree Display for Strain: WBStrain00051920
expand all nodes | collapse all nodes | view schema
WBStrain00051920 | Status | Live | ||
---|---|---|---|---|
Genotype | F26E4.4(gk5646[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/hT2 [umnIs73] I; +/hT2 [bli-4(e937) let-?(h661)] III. | |||
Public_name | RG5025 | |||
Contains | Gene | WBGene00000254 | ||
WBGene00003514 | ||||
WBGene00004496 | ||||
WBGene00006789 | ||||
Variation | WBVar00143617 | |||
WBVar00146626 | ||||
Rearrangement | hT2 | |||
Transgene | WBTransgene00033238 | |||
Properties | Mutagen | CRISPR_Cas9 | ||
CGC_received | 15 Oct 2021 00:00:00 | |||
Location | CGC | |||
Remark | umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged hT2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5646 homozygotes), lethal non-GFP mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Derived from parental strains VC4575 and CGC92. gk5646 is a 1524 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CAAAAAAACTGGATAACAATAAATTGGCAA; Right flanking sequence: TGGAAAACGCACGCGACGCGTGACCGCAGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. | Inferred_automatically | From CGC strain data | |
Made_by: Morgan Zaic | CGC_data_submission | |||
Species | Caenorhabditis elegans |