WormBase Tree Display for Strain: WBStrain00051887

WBStrain00051887 Status: Live
  Genotype: +/mT1 [umnIs52] II; Y48A6C.4(ve745[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III.
  Public_name: RG3245
  Contains: Gene: WBGene00001072
      WBGene00003514
      WBGene00004496
      WBGene00006789
    Variation: WBVar00142982
    Rearrangement: mT1
    Transgene: WBTransgene00033218
  Properties: Outcrossed: x0
    Mutagen: CRISPR_Cas9
    CGC_received: 29 Nov 2021 00:00:00
  Location: CGC
  Remark: umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous larval arrest. Deletion of 6712 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve745 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: tgggaataattttctctcgaatcaatatct ; Right flanking sequence: tttaattttttaaagttaaaaattttctag. sgRNA #1: atgaaacttgcacttcaccg; sgRNA #2: aagcggagtcgggaagaggg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. Inferred_automatically: From CGC strain data
    Made_by: RG KO Group CGC_data_submission
  Species: Caenorhabditis elegans