WormBase Tree Display for Variation: WBVar00142982
expand all nodes | collapse all nodes | view schema
WBVar00142982 | Evidence | Paper_evidence | WBPaper00001792 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | e128 | |||||||
Other_name | T14B4.7.1:c.205-1G>A | ||||||||
T14B4.19.1:c.*101-1G>A | |||||||||
HGVSg | CHROMOSOME_II:g.6711280C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | T14B4 | |||||
Flanking_sequences | ctattgtataaaatttttttcaactcttca | agatcaaacgacgaggctgcacttgaactt | |||||||
Mapping_target | T14B4 | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00001792 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain (660) | |||||||||
Laboratory | CB | ||||||||
VC | |||||||||
BN | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00001072 | |||||||
WBGene00302993 | |||||||||
Transcript | T14B4.7.1 | VEP_consequence | splice_acceptor_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | T14B4.7.1:c.205-1G>A | ||||||||
Intron_number | 4/6 | ||||||||
T14B4.19.1 | VEP_consequence | splice_acceptor_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | T14B4.19.1:c.*101-1G>A | ||||||||
Intron_number | 6/6 | ||||||||
Interactor (23) | |||||||||
Genetics | Interpolated_map_position | II | 0.000998201 | ||||||
Mapping_data | In_2_point (40) | ||||||||
In_multi_point (151) | |||||||||
In_pos_neg_data (26) | |||||||||
Marked_rearrangement | mIn1[dpy-10(e128) let-?(m727)] | ||||||||
mIn1[dpy-10(e128) mIs14(myo-2::GFP)] | |||||||||
mIn1[dpy-10(e128)] | |||||||||
mIn1[rol-1(e91) dpy-10(e128)] | |||||||||
mIn1[unc-4(e120) dpy-10(e128)] | |||||||||
Description | Phenotype (20) | ||||||||
Phenotype_not_observed | WBPhenotype:0000505 | Paper_evidence | WBPaper00001328 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Males are not Ram. | Paper_evidence | WBPaper00001328 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006941 | PATO:0000460 | Paper_evidence | WBPaper00001328 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00001328 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 20C | Paper_evidence | WBPaper00001328 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Genotype | him-5(e1490) | Paper_evidence | WBPaper00001328 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000645 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | non-roller | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001426 | Paper_evidence | WBPaper00004883 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | arIs37 | Paper_evidence | WBPaper00004883 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001678 | Paper_evidence | WBPaper00003994 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
Remark | There was no change in the hydroxyproline content of cuticle collagen from dpy-10 (e128) animals compared with wild-type cuticle extracts. This is in contrast to the reduction of hydroxyproline content found in dpy-18 (e1096) and dpy-18 (e364) animals. | Paper_evidence | WBPaper00003994 | ||||||
Curator_confirmed | WBPerson557 | ||||||||
Disease_info | Models_disease | DOID:37 | |||||||
Models_disease_in_annotation | WBDOannot00001178 | ||||||||
Reference (45) | |||||||||
Remark | Variation stub/paper connection generated from the May 2021 NN VFP dataset. | ||||||||
Created by WBPerson51134 from the NN_VFP_triage_pipeline | |||||||||
Method | Substitution_allele |