WormBase Tree Display for Strain: WBStrain00051881
expand all nodes | collapse all nodes | view schema
| WBStrain00051881 | Status | Live | ||
|---|---|---|---|---|
| Genotype | ZK858.7(ve739[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT2 [umnIs73] I; unc-36(e251)/hT2 [bli-4(e937) let-?(h661)] III. | |||
| Public_name | RG3239 | |||
| Contains | Gene | WBGene00000254 | ||
| WBGene00003514 | ||||
| WBGene00004496 | ||||
| WBGene00006772 | ||||
| WBGene00006789 | ||||
| Variation | WBVar00143063 | |||
| WBVar00143617 | ||||
| WBVar00146626 | ||||
| Rearrangement | hT2 | |||
| Transgene | WBTransgene00033238 | |||
| Properties | Outcrossed | x0 | ||
| Mutagen | CRISPR_Cas9 | |||
| CGC_received | 11 Nov 2021 00:00:00 | |||
| Location | CGC | |||
| Remark | umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Homozygous lethal. Deletion of 2453 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 lethals(lethal mid-larval to adult) (ve739 homozygotes), non-GFP mKate2+ arrested animals (arrest stage unknown)(hT2 homozygotes) and dead eggs (aneuploids). Pick wild-type GFP+ mKate2+ and check for correct segregation of progeny to maintain. [NOTE: Apparently the lethal mutation in hT2 is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)] Left flanking Sequence: catattattaaattttaagtgtaaaagatt ; Right flanking sequence: aggcaacagagaacgaacgataaagtagtc. sgRNA #1: gaggaaatatgcaatttact; sgRNA #2: atcgacgagacggctacgaa. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. | Inferred_automatically | From CGC strain data | |
| Made_by: RG KO Group | CGC_data_submission | |||
| Species | Caenorhabditis elegans |
