WormBase Tree Display for Strain: WBStrain00051691
expand all nodes | collapse all nodes | view schema
| WBStrain00051691 | Status | Live | ||
|---|---|---|---|---|
| Genotype | nhr-8(utx33[mNG::3xFlag::nhr-8]) IV. | |||
| Public_name | GLW41 | |||
| Contains | Gene | WBGene00003607 | ||
| Properties | Outcrossed | x0 | ||
| Mutagen | CRISPR_Cas9 | |||
| CGC_received | 21 Dec 2021 00:00:00 | |||
| Location | CGC | |||
| Remark | N-terminal tag of NHR-8 via CRISPR/Cas9 knock-in of mNeonGreen at nhr-8 locus. Insertion verified by PCR and Sanger sequencing. Left flank: 5' taatcactaaaacaaaaatttcgtcattcc 3'; Right flank: 5' ATGCCTTCGTCTTCTCCATCGATGGACGAG 3'; sgRNA: CGATGGAGAAGACGAAGGCA; Cas9/sgRNA plasmid: pGLOW55; mNG^SEC^3xFlag plasmid: pGLOW56; SEC insertion allele strain: GLW40. | Inferred_automatically | From CGC strain data | |
| Made_by: Gillian Witten (Glow Worms '21) | CGC_data_submission | |||
| Species | Caenorhabditis elegans |
