WormBase Tree Display for Strain: WBStrain00050999
expand all nodes | collapse all nodes | view schema
WBStrain00050999 | Status | Live | ||
---|---|---|---|---|
Genotype | otpl-8(sy1592) X. | |||
Public_name | PS8990 | |||
Contains | Gene | WBGene00010403 | ||
Variation | WBVar02157504 | |||
Properties | Outcrossed | xNo | ||
Mutagen | CRISPR_Cas9 | |||
CGC_received | 18 Feb 2021 00:00:00 | |||
Location | CGC | |||
Remark | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of otpl-8; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).Left flanking sequence: CATCACCCACACATCATCATGAACTCTACCGACGARight flanking sequence: CCTTGGATTCATGAGCCAAGAGCCACgtaagtctaginserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : ATGAACTCTACCGACGACCT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 | Inferred_automatically | From CGC strain data | |
Made_by: Heenam Park | CGC_data_submission | |||
Species | Caenorhabditis elegans |