WormBase Tree Display for Strain: WBStrain00049343

WBStrain00049343 Evidence: Curator_confirmed: WBPerson1983
  Status: Live
  Genotype: cwc-15(ve604[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/sC4(s2172) [dpy-21(e428)] V.
  Public_name: RG3104
  Contains: Gene: WBGene00001080
      WBGene00003514
      WBGene00004496
      WBGene00006789
      WBGene00011687
    Variation: WBVar02154163
      WBVar00143205
    Rearrangement: sC4
  Properties: Outcrossed: x0
    Mutagen: CRISPR_Cas9
    CGC_received: 06 Jul 2020 00:00:00
  Location: CGC
  Remark: ?. Deletion of 1421 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, GFP+ PHENOTYPIC DESCRIPTION (ve604 homozygotes) and arrested non-GFP (stage unknown) (sC4 homozygotes). Maintain by picking wild-type GFP+. Left flanking Sequence: aactcatattcaaaactcgcgccgaaatgt ; Right flanking sequence: gtaggccgtatcgacttttcaagtactttt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
    Homozygous larval arrest. Deletion of 1421 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, GFP+ clear young larvae easiest to see at the edge of the lawn (ve604 homozygotes) and arrested non-GFP (stage unknown) (sC4 homozygotes). Maintain by picking wild-type GFP+. Left flanking Sequence: aactcatattcaaaactcgcgccgaaatgt ; Right flanking sequence: gtaggccgtatcgacttttcaagtactttt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. Inferred_automatically: From CGC strain data
    Made_by: RG KO Group CGC_data_submission
  Species: Caenorhabditis elegans