WormBase Tree Display for Strain: WBStrain00047599
expand all nodes | collapse all nodes | view schema
| WBStrain00047599 | Status | Live | ||
|---|---|---|---|---|
| Genotype | R05D3.8(gk5088[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/qC1[dpy-19(e1259) glp-1(q339)] III. | |||
| Public_name | VC4238 | |||
| Contains | Gene | WBGene00001078 | ||
| WBGene00001609 | ||||
| WBGene00003514 | ||||
| WBGene00004496 | ||||
| WBGene00006789 | ||||
| Variation | WBVar00143868 | |||
| WBVar00241080 | ||||
| WBVar02156330 | ||||
| Rearrangement | qC1 | |||
| Properties | Outcrossed | x1 | ||
| Mutagen | CRISPR_Cas9 | |||
| CGC_received | 05 Nov 2019 00:00:00 | |||
| Location | CGC | |||
| Remark | Homozygous lethal or sterile deletion balanced by qC1. Deletion of 1366 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain; homozygous qC1 is non-GFP sterile TS Dpy. Left flanking sequence: TCATTTTGTATAATGTTTTATTCTCGGTCA; Right flanking sequence: GGAGGTAGAATGCACTCGTATAAAGTTCCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. | Inferred_automatically | From CGC strain data | |
| Made_by: Vancouver KO Group | CGC_data_submission | |||
| Species | Caenorhabditis elegans |
