WormBase Tree Display for Strain: WBStrain00047577
expand all nodes | collapse all nodes | view schema
| WBStrain00047577 | Status | Live | ||
|---|---|---|---|---|
| Genotype | R12C12.6(gk5239) II; clec-56(gk5240) V. | |||
| Public_name | VC4156 | |||
| Contains | Gene | WBGene00008595 | ||
| WBGene00020026 | ||||
| Variation | WBVar02152992 | |||
| WBVar02152993 | ||||
| Properties | Outcrossed | x0 | ||
| Mutagen | EMS | |||
| CGC_received | 05 Nov 2019 00:00:00 | |||
| Location | CGC | |||
| Remark | Homozygous viable. Nonsense alleles identified by amplicon sequencing. The gk5239 mutation is A->T, flanking sequences AAATTTTAAAAGACTCGGACAAATGCATCG and CATCGTGTATCTTCGAAGTTAGCCTGAAAA. The gk5240 mutation is G->A, flanking sequences ATGCTGACACCAATCACTGCCCTCTTGGAT and GACCTTCTCCACCAATACTTCTTACTGTTA. | Inferred_automatically | From CGC strain data | |
| Made_by: Vancouver KO Group | CGC_data_submission | |||
| Species | Caenorhabditis elegans |
