WormBase Tree Display for Strain: WBStrain00047576
expand all nodes | collapse all nodes | view schema
| WBStrain00047576 | Status | Live | ||
|---|---|---|---|---|
| Genotype | fbxa-182(gk5217) II; srbc-70(gk5218) IV. | |||
| Public_name | VC4135 | |||
| Contains | Gene | WBGene00017935 | ||
| WBGene00018353 | ||||
| Variation | WBVar02152990 | |||
| WBVar02152991 | ||||
| Properties | Outcrossed | x0 | ||
| Mutagen | EMS | |||
| CGC_received | 05 Nov 2019 00:00:00 | |||
| Location | CGC | |||
| Remark | Homozygous viable. Nonsense alleles identified by amplicon sequencing. The gk5217 mutation is C->T, flanking sequences GCTGATGCGGACATCCAACTTAGTTAAAAT and CATTCATTTGTGGCTTGACATAAATTATAT. The gk5218 mutation is C->T, flanking sequences GTGATCAGTTCTATTTTTGGTGCAGAACTT and CAGACGAAAAGTCGAATGGCAAGAACTGCT. | Inferred_automatically | From CGC strain data | |
| Made_by: Vancouver KO Group | CGC_data_submission | |||
| Species | Caenorhabditis elegans |
