WormBase Tree Display for Strain: WBStrain00047556
expand all nodes | collapse all nodes | view schema
| WBStrain00047556 | Status | Live | ||
|---|---|---|---|---|
| Genotype | tni-4(gk5170) IV. | |||
| Public_name | VC4083 | |||
| Contains | Gene | WBGene00006586 | ||
| Variation | WBVar02152966 | |||
| Properties | Outcrossed | x0 | ||
| Mutagen | EMS | |||
| CGC_received | 05 Nov 2019 00:00:00 | |||
| Location | CGC | |||
| Remark | Homozygous viable. Splicing allele identified by amplicon sequencing. The gk5170 mutation is G->A, flanking sequences TCATTCCACTTCCAGATTTGGATAACGAAG and TAAGTGTTCTGAAGATGAAAACAACTATTT. | Inferred_automatically | From CGC strain data | |
| Made_by: Vancouver KO Group | CGC_data_submission | |||
| Species | Caenorhabditis elegans |
