WormBase Tree Display for Strain: WBStrain00047536

WBStrain00047536 Status: Live
  Genotype: pry-1(gk3681[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I; F56E10.1(gk3701) V.
  Public_name: VC3709
  Contains: Gene: WBGene00003514
      WBGene00004202
      WBGene00004496
      WBGene00006789
      WBGene00018975
    Variation: WBVar02153585
      WBVar02157315
  Properties: Outcrossed: x0
    Mutagen: CRISPR_Cas9
    CGC_received: 05 Nov 2019 00:00:00
  Location: CGC
  Remark: Homozygous viable. Deletion of 720 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TAGGGGCCCCTCCCGGTAGCCGGTCGAGCG; Right flanking sequence: GGATTTTTCTGCGAAATTTGGATTTAGCTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. Inferred_automatically: From CGC strain data
    Made_by: Vancouver KO Group CGC_data_submission
    Homozygous viable. Primary deletion of 720 bp in pry-1 with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TAGGGGCCCCTCCCGGTAGCCGGTCGAGCG; Right flanking sequence: GGATTTTTCTGCGAAATTTGGATTTAGCTT. Strain carries secondary 5-bp deletion in F56E10.1, with flanking sequences GGCGCCGGCGGTGAAGAGGATGAGGACAAT and GGATTCAGAAGAAGAAGATGAAGAAGACTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. Inferred_automatically: From CGC strain data
  Species: Caenorhabditis elegans