WormBase Tree Display for Strain: WBStrain00047460
expand all nodes | collapse all nodes | view schema
| WBStrain00047460 | Evidence | Curator_confirmed | WBPerson1983 | |
|---|---|---|---|---|
| Status | Live | |||
| Genotype | sue-1(ve554[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. | |||
| Public_name | RG3054 | |||
| Contains | Gene | WBGene00003514 | ||
| WBGene00004496 | ||||
| WBGene00006306 | ||||
| WBGene00006789 | ||||
| Variation | WBVar02154003 | |||
| Properties | Outcrossed | x0 | ||
| Mutagen | CRISPR_Cas9 | |||
| CGC_received | 10 Jul 2019 00:00:00 | |||
| Location | CGC | |||
| Remark | Made_by: RG KO Group | CGC_data_submission | ||
| Homozygous viable. Deletion of 10676 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: aaattttgtgggaataaacgcacaccgcga ; Right flanking sequence: caaggtgaaaaagaaaacaaatagttactg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. | Inferred_automatically | From CGC strain data | ||
| Species | Caenorhabditis elegans |
