WormBase Tree Display for Strain: WBStrain00033122
expand all nodes | collapse all nodes | view schema
WBStrain00033122 | Status | Live | ||
---|---|---|---|---|
Genotype | str-220(ok3374) IV. | |||
Public_name | RB2447 | |||
Contains | Gene | WBGene00006251 | ||
Variation | WBVar00094394 | |||
Properties | Outcrossed | x0 | ||
Mutagen | EMS | |||
CGC_received | 29 Oct 2008 00:00:00 | |||
Location | CGC | |||
Remark | This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | |
C42D4.9 Homozygous. Outer Left Sequence: tgtaacacggcaggttcaaa. Outer Right Sequence: acattccgttttccatttgc. Inner Left Sequence: ttggcgccacttcttcttta. Inner Right Sequence:ccagactgtccaaaatccaga . Inner Primer PCR Length: 1146. Deletion size: about 300 bp. | Inferred_automatically | From CGC strain data | ||
Made_by: OMRF Knockout Group | CGC_data_submission | |||
Species | Caenorhabditis elegans |