Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Strain: WBStrain00033122

expand all nodes | collapse all nodes | view schema

Name Class

WBStrain00033122StatusLive
Genotypestr-220(ok3374) IV.
Public_nameRB2447
ContainsGeneWBGene00006251
VariationWBVar00094394
Properties (3)
LocationCGC
RemarkThis strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.Paper_evidenceWBPaper00041807
C42D4.9 Homozygous. Outer Left Sequence: tgtaacacggcaggttcaaa. Outer Right Sequence: acattccgttttccatttgc. Inner Left Sequence: ttggcgccacttcttcttta. Inner Right Sequence:ccagactgtccaaaatccaga . Inner Primer PCR Length: 1146. Deletion size: about 300 bp.Inferred_automaticallyFrom CGC strain data
Made_by: OMRF Knockout GroupCGC_data_submission
SpeciesCaenorhabditis elegans