WormBase Tree Display for Strain: WBStrain00029073
expand all nodes | collapse all nodes | view schema
| WBStrain00029073 | Status | Live | ||
|---|---|---|---|---|
| Genotype | rep-1(ok3296)/sC1(s2023) [dpy-1(s2170)] III. | |||
| Public_name | NM4337 | |||
| Contains | Gene | WBGene00001063 | ||
| WBGene00022051 | ||||
| Variation | WBVar00242254 | |||
| WBVar00094339 | ||||
| Rearrangement | sC1 | |||
| Properties | Outcrossed | x0 | ||
| CGC_received | 15 Dec 2014 00:00:00 | |||
| Location | CGC | |||
| Made_by | WBPerson451 | |||
| Remark | rep-1(ok3296) homozygotes arrest as uncoordinated non-pumping starved L2/L3 animals. sC1(s2023) dpy-1 homozygotes are viable dpy animals. Heterozygotes are wild-type. Pick wild-type and check for correct segregation of progeny to maintain. ok3296 deletes 556 bp including the first 54 bp of exon 6 and has the sequence junction AGCTGAAACCGGTGCTACAG/CCATTCCTCTTCCCACTCTA. This strain replaces RB2411, which was an unbalanced heterozygous strain; also see NM4431. Reference: Dour S and Nonet ML. In preparation. | Inferred_automatically | From CGC strain data | |
| Species | Caenorhabditis elegans |
