WormBase Tree Display for Strain: WBStrain00029073
expand all nodes | collapse all nodes | view schema
WBStrain00029073 | Status | Live | ||
---|---|---|---|---|
Genotype | rep-1(ok3296)/sC1(s2023) [dpy-1(s2170)] III. | |||
Public_name | NM4337 | |||
Contains (3) | ||||
Properties (2) | ||||
Location | CGC | |||
Made_by | WBPerson451 | |||
Remark | rep-1(ok3296) homozygotes arrest as uncoordinated non-pumping starved L2/L3 animals. sC1(s2023) dpy-1 homozygotes are viable dpy animals. Heterozygotes are wild-type. Pick wild-type and check for correct segregation of progeny to maintain. ok3296 deletes 556 bp including the first 54 bp of exon 6 and has the sequence junction AGCTGAAACCGGTGCTACAG/CCATTCCTCTTCCCACTCTA. This strain replaces RB2411, which was an unbalanced heterozygous strain; also see NM4431. Reference: Dour S and Nonet ML. In preparation. | Inferred_automatically | From CGC strain data | |
Species | Caenorhabditis elegans |