WormBase Tree Display for Strain: WBStrain00024078
expand all nodes | collapse all nodes | view schema
| WBStrain00024078 | Status | Live | ||
|---|---|---|---|---|
| Genotype | ife-4(ok320) X. | |||
| Public_name | KX17 | |||
| Contains | Gene | WBGene00002062 | ||
| Variation | WBVar00091618 | |||
| Properties | Outcrossed | x10 | ||
| Mutagen | UV+TMP | |||
| CGC_received | 24 Oct 2003 00:00:00 | |||
| Location | CGC | |||
| Made_by | WBPerson1666 | |||
| Remark | C05D9.5 Homozygous. Deletion of 1778 bp removes 1088 bp upstream of start codon and all of exons 1 and 2. IFE-4 is absent from m7GTP-affinity purified protein; other IFEs are present. Breakpoint determined by BDK is CATCGAGTCGGGACGTGATG/AGTAGTGCAAGACTGATAAA. Eukaryotic translation initiation factor 4E gene (isoform 4). | Inferred_automatically | From CGC strain data | |
| Mutagen:UV/TMP | Curator_confirmed | WBPerson1983 | ||
| Species | Caenorhabditis elegans |
