WormBase Tree Display for Strain: WBStrain00005388
expand all nodes | collapse all nodes | view schema
| WBStrain00005388 | Status | Live | ||
|---|---|---|---|---|
| Genotype | gcy-33(ok232) V. | |||
| Public_name | CZ3715 | |||
| Contains | Gene | WBGene00001553 | ||
| Variation | WBVar00091535 | |||
| Properties | Outcrossed | x4 | ||
| Mutagen | UV+TMP | |||
| CGC_received | 19 Aug 2003 00:00:00 | |||
| Location | CGC | |||
| Made_by | WBPerson1096 | |||
| Remark | 1237bp deletion in cosmid F57F5. Break points are 743 and 1980 with respect to F57F5. Sequence at the break point is: TGAGAAGTTTATAAAAAAGTA / AAACTTAAGAGTTTTCAGTCA. Primers: ok232u1: GGATTGCTTACGTGCATC; ok232d1: ATTACATTTGCAGAAACTCG; ok232d2: CTCTTCTCACTCAAATGATG. ok232u1/d1 = 322bp product with WT allele. ok232d2/u1 = 397bp product with ok232 allele. | Inferred_automatically | From CGC strain data | |
| Mutagen:UV/TMP | Curator_confirmed | WBPerson1983 | ||
| Species | Caenorhabditis elegans |
