WormBase Tree Display for Strain: WBStrain00005036
expand all nodes | collapse all nodes | view schema
| WBStrain00005036 | Status | Live | ||
|---|---|---|---|---|
| Genotype | zmp-1(cg115) III. | |||
| Public_name | CH1315 | |||
| Contains | Gene | WBGene00006987 | ||
| Variation | WBVar00054132 | |||
| Properties | Outcrossed | x7 | ||
| Mutagen | Tc1 | |||
| CGC_received | 03 Mar 2010 00:00:00 | |||
| Location | CGC | |||
| Made_by | WBPerson345 | |||
| Remark | Mutagen:Tc1 Excision | Curator_confirmed | WBPerson1983 | |
| Superficially wild-type. 2366 bp deletion (965-3330 of U41266(EGAP1)) caused by imprecise excision of Tc1. Deletion can be detected by PCR with primers DSP4 (AATTAGTTGACGAGACAAGTCAGG) and B3 (AGTGAAGGCAGAATGTACTCC) --306 kb WT vs 1.2 kb mutant. | Inferred_automatically | From CGC strain data | ||
| Species | Caenorhabditis elegans |
