WormBase Tree Display for RNAi: WBRNAi00115650
expand all nodes | collapse all nodes | view schema
WBRNAi00115650 | Homol | Homol_homol | F11C1:RNAi | ||
---|---|---|---|---|---|
Sequence_info | DNA_text | ATGACTGACGTCGAGAGGATGGTTCTGCGACCGAATCATGAAGGCGAGATGTGCCCGGTTTGTGGTGATCGAGTCTCTGGATATCACTACGGCCTTCTGACGTGTGAAAGTTGCAAGGGCTTCTTCAAAC | |||
Experiment | Delivered_by | Injection | |||
Inhibits | Predicted_gene | F11C1.6a | Inferred_automatically | RNAi_primary | |
Gene | WBGene00003623 | Inferred_automatically | RNAi_primary | ||
Transcript | F11C1.6a.1 | Inferred_automatically | RNAi_primary | ||
F11C1.6a.2 | Inferred_automatically | RNAi_primary | |||
Species | Caenorhabditis elegans | ||||
Reference | WBPaper00004124 | ||||
Phenotype | WBPhenotype:0000698 | Remark | Although disruption of nhr-25 function via RNAi usually leads to embryonic arrest due to failure of the epidermally mediated process of embryo elongation, animals that survive to adulthood were sterile and vulvaless. | ||
Method | RNAi |