WormBase Tree Display for RNAi: WBRNAi00115648
expand all nodes | collapse all nodes | view schema
| WBRNAi00115648 | Homol | Homol_homol | F11C1:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | ATGACTGACGTCGAGAGGATGGTTCTGCGACCGAATCATGAAGGCGAGATGTGCCCGGTTTGTGGTGATCGAGTCTCTGGATATCACTACGGCCTTCTGACGTGTGAAAGTTGCAAGGGCTTCTTCAAAC | |||
| Experiment | Delivered_by | Injection | |||
| Inhibits | Predicted_gene | F11C1.6a | Inferred_automatically | RNAi_primary | |
| Gene | WBGene00003623 | Inferred_automatically | RNAi_primary | ||
| Transcript | F11C1.6a.1 | Inferred_automatically | RNAi_primary | ||
| F11C1.6a.2 | Inferred_automatically | RNAi_primary | |||
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00004124 | ||||
| Phenotype | WBPhenotype:0000059 | Remark | Of the nhr-25(RNAi) animals that did hatch, the majority were abnormal and arrested growth at the L1 or L2 stage. | ||
| Method | RNAi |
