WormBase Tree Display for RNAi: WBRNAi00115647
expand all nodes | collapse all nodes | view schema
| WBRNAi00115647 | Homol | Homol_homol | F11C1:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | ATGACTGACGTCGAGAGGATGGTTCTGCGACCGAATCATGAAGGCGAGATGTGCCCGGTTTGTGGTGATCGAGTCTCTGGATATCACTACGGCCTTCTGACGTGTGAAAGTTGCAAGGGCTTCTTCAAAC | |||
| Experiment | Delivered_by | Injection | |||
| Inhibits | Predicted_gene | F11C1.6a | Inferred_automatically | RNAi_primary | |
| Gene | WBGene00003623 | Inferred_automatically | RNAi_primary | ||
| Transcript | F11C1.6a.1 | Inferred_automatically | RNAi_primary | ||
| F11C1.6a.2 | Inferred_automatically | RNAi_primary | |||
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00004124 | ||||
| Phenotype | WBPhenotype:0000399 | Remark | Although disruption of nhr-25 function via RNAi usually leads to embryonic arrest due to failure of the epidermally mediated process of embryo elongation, animals that survive to hatching arrest as misshapen larvae that occasionally exhibit defects in shedding molted cuticle. In addition, somatic gonad development is defective in these larvae. | ||
| WBPhenotype:0000750 | Remark | Although disruption of nhr-25 function via RNAi usually leads to embryonic arrest due to failure of the epidermally mediated process of embryo elongation, animals that survive to hatching arrest as misshapen larvae that occasionally exhibit defects in shedding molted cuticle. In addition, somatic gonad development is defective in these larvae. | |||
| WBPhenotype:0002041 | Remark | Although disruption of nhr-25 function via RNAi usually leads to embryonic arrest due to failure of the epidermally mediated process of embryo elongation, animals that survive to hatching arrest as misshapen larvae that occasionally exhibit defects in shedding molted cuticle. In addition, somatic gonad development is defective in these larvae. | |||
| Method | RNAi |
