WormBase Tree Display for RNAi: WBRNAi00108168
expand all nodes | collapse all nodes | view schema
| WBRNAi00108168 | Homol | Homol_homol | K02F3:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | cagtcttcaaatggatcatatgattttctaacaagtcgccctttcgacgtcctgtcaatgcaatgtgtgatcaaaaagaaaactccgcttatcaatcttcaattcttatcaaatgacgttatgaagaattgaagcaaaagtccaatgtgcgattgtttaaatggaatgtatatgttctatgaagttgttattatacctatgtgttaaattcaaatatcgaaaataagcaaatgttaataaatttgctcatagaacgcacaagtaatgagttcacaccatatcttgtctgtatataaaaattc | |||
| Experiment | Delivered_by | Bacterial_feeding | |||
| Inhibits | Gene | WBGene00019327 | Inferred_automatically | RNAi_primary | |
| WBGene00219709 | Inferred_automatically | RNAi_primary | |||
| Transcript | K02F3.4.3 | Inferred_automatically | RNAi_primary | ||
| K02F3.14 | Inferred_automatically | RNAi_primary | |||
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00049772 | ||||
| Phenotype_not_observed | WBPhenotype:0000039 | Remark | Knockdown of linc-37 by RNAi did not obviously affect longevity and locomotion behavior, or induce the noticeable intestinal ROS production compared with wild-type N2. | ||
| WBPhenotype:0000643 | Remark | Knockdown of linc-37 by RNAi did not obviously affect longevity and locomotion behavior, or induce the noticeable intestinal ROS production compared with wild-type N2. | |||
| WBPhenotype:0002182 | Remark | Knockdown of linc-37 by RNAi did not obviously affect longevity and locomotion behavior, or induce the noticeable intestinal ROS production compared with wild-type N2. | |||
| Remark | Exact sequence used for RNAi not stated by authors, putative transcript sequence of gene used for curation. | ||||
| Method | RNAi |
