WormBase Tree Display for RNAi: WBRNAi00101453

WBRNAi00101453 Homol: Homol_homol: B0336:RNAi
  Sequence_info: DNA_text: ATGGATGTGGATTGCGCAGAAACATTCTCGCAACCATGCACTCCGCTGAATTTCAATCCGATGACTCCGTCAACATCGAGAGTTTCAACACCAGTTCGGCCGTCTTCTACAATGTCTGCCAGACAATATTCAGGTTCGCCGTTCAAGGCTCAACCTCAGAACATGGAACCGTCCAATTCTCGGGTGCAAGAACTCCGGGAAGCTGCTGTGGGAAAGCGATCATACACAAATGCTTGGATGCAGGGTACCTATGCACCGCCGCAGATGGCAGGACAACAACAAAGGTTTTCGAGGCCTCCGAGTGTGATCGGCTCCACAATGTCTCACATGACGAATATGTCAGAAATGACCGCCTACTCGTACGGTGGATTGTCAATGCTCTCAGTCAACACTGAAATGGGTGAATTCAACAATTTTGTCAATCAGGCACCATATCAGCGAGCACTGACACGTGTATCGCAGGTTTCCGAGAATCAGGATCCGACGAATCGACAGTATCCGATGACAGCTCCCGAGATTATTGAGAATCTGGAATCAACGGAACTAATCAATCAAGCAGCAGCGATTCGAGCTTTGGAGCCAATTGTGAAAGCTGGTGGAATGTTGCAAACCTGGGGACCTAAAGGAGCCGAACCGATTATTCGAGCTCT
  Experiment: Laboratory: JK
    Date: 23 Oct 2001 00:00:00
    Treatment: dsRNA to each gene was injected into N2 at both 2.5 and 1 mg/ml. Injected animals were crossed with N2 males or males carrying GFP reporters.
    Delivered_by: Injection
  Inhibits: Predicted_gene: B0336.1a Inferred_automatically: RNAi_primary
      B0336.1b Inferred_automatically: RNAi_primary
    Gene: WBGene00006943 Inferred_automatically: RNAi_primary
    Transcript: B0336.1b.1 Inferred_automatically: RNAi_primary
      B0336.1a.1 Inferred_automatically: RNAi_primary
  Species: Caenorhabditis elegans
  Reference: WBPaper00005116
  Phenotype: WBPhenotype:0001586 Remark: wrm-1 RNAi resulted in a completely penetrant Sys (somatic gonad precursor symmetrical sisters) phenotype as indicated by missing distal tip cells (in males and hermaphrodites), extra anchor cells (in hermaphrodites), and extra linker cells (in males)
      Penetrance: Complete
      EQ_annotations: Anatomy_term: WBbt:0006865 PATO:0000460
    WBPhenotype:0001962 Remark: wrm-1 RNAi resulted in a completely penetrant Sys (somatic gonad precursor symmetrical sisters) phenotype as indicated by missing distal tip cells (in males and hermaphrodites), extra anchor cells (in hermaphrodites), and extra linker cells (in males)
      Penetrance: Complete
      EQ_annotations: Anatomy_term: WBbt:0006865 PATO:0000460
    WBPhenotype:0001968 Remark: wrm-1 RNAi resulted in a completely penetrant Sys (somatic gonad precursor symmetrical sisters) phenotype as indicated by missing distal tip cells (in males and hermaphrodites), extra anchor cells (in hermaphrodites), and extra linker cells (in males)
      Penetrance: Complete
      EQ_annotations: Anatomy_term: WBbt:0006865 PATO:0000460
    WBPhenotype:0002189 Remark: wrm-1 RNAi resulted in a completely penetrant Sys (somatic gonad precursor symmetrical sisters) phenotype as indicated by missing distal tip cells (in males and hermaphrodites), extra anchor cells (in hermaphrodites), and extra linker cells (in males)
      Penetrance: Complete
      EQ_annotations: Anatomy_term: WBbt:0006865 PATO:0000460
  Remark: (Table 4) wrm-1 RNAi. Authors report generating dsRNA by RT-PCR to the 5' end of the gene and that clones contained at least 650bp of exon sequence. First 650bp of coding region of cDNA used for curation.
  Method: RNAi