WormBase Tree Display for RNAi: WBRNAi00101448
expand all nodes | collapse all nodes | view schema
| WBRNAi00101448 | Homol | Homol_homol | W01B6:RNAi | |||
|---|---|---|---|---|---|---|
| Sequence_info | DNA_text | ATGATTCCACGGAGAAGTTGTTGGCTCATACTTCTTCTTAATTTATTAAATGTTCAATCATTATTAGATGCTTCTTGGTGGTCAACAGTTGCACAATTGTCAACTGCTTTAGCAGGGCATAACGTGAAGCCTGTATGCGAATTACCCGGACTTTCGCCTGGTCAAGCTCAAGTATGTGAGCTTTTCAAAGATCATATGCCAGCTGTGAGCATCGGAGCACAAAATGCTATTCAGGAATGTCAACGACAATTCACAGGTCATCGATGGAATTGTTCAACACACTACAGTACAGGAATGCTTGGACCAATTCATAAAATGGCAACACGAGAAGCTGCATTCACATACGCAATTCTATCAGCTGGAGTTACACATGAAATTGGAAGACGGTGCAAACAGGGACTTTTAACTTCATGTGGATGCTCTGATGAGACTAAACCAAAAAATGTTCCAACAGATTGGAGTTGGGGTGGATGTGGAGATAATGTTGAATATGGTTACAAGTTTTCGAGAGATTTTATTGATATTCGAGAGAAAGAACACGATCCAAAGAGAAATCACGATAACGGTAGAAGTTTAATGAATCGAAGAAATAACGAAGCTGGAAGAAAAATTTTGAAACGTCATCGAAAACCAAAATGCAAATGCCATGG | ||||
| Experiment | Laboratory | JK | ||||
| Date | 23 Oct 2001 00:00:00 | |||||
| Treatment | dsRNA to each gene was injected into N2 at both 2.5 and 1 mg/ml. Injected animals were crossed with N2 males or males carrying GFP reporters. | |||||
| Delivered_by | Injection | |||||
| Inhibits | Predicted_gene | W01B6.1 | Inferred_automatically | RNAi_primary | ||
| Gene | WBGene00000858 | Inferred_automatically | RNAi_primary | |||
| Transcript | W01B6.1.1 | Inferred_automatically | RNAi_primary | |||
| Species | Caenorhabditis elegans | |||||
| Reference | WBPaper00005116 | |||||
| Phenotype_not_observed | WBPhenotype:0001586 | Remark | RNAi did not result in a Sys (somatic gonad precursor symmetrical sisters) phenotype as indicated by no missing distal tip cells (in males or hermaphrodites), no extra anchor cells (in hermaphrodites), and no extra linker cells (in males) | |||
| EQ_annotations | Anatomy_term | WBbt:0006865 | PATO:0000460 | |||
| WBPhenotype:0001962 | Remark | RNAi did not result in a Sys (somatic gonad precursor symmetrical sisters) phenotype as indicated by no missing distal tip cells (in males or hermaphrodites), no extra anchor cells (in hermaphrodites), and no extra linker cells (in males) | ||||
| EQ_annotations | Anatomy_term | WBbt:0006865 | PATO:0000460 | |||
| WBPhenotype:0001968 | Remark | RNAi did not result in a Sys (somatic gonad precursor symmetrical sisters) phenotype as indicated by no missing distal tip cells (in males or hermaphrodites), no extra anchor cells (in hermaphrodites), and no extra linker cells (in males) | ||||
| EQ_annotations | Anatomy_term | WBbt:0006865 | PATO:0000460 | |||
| WBPhenotype:0002189 | Remark | RNAi did not result in a Sys (somatic gonad precursor symmetrical sisters) phenotype as indicated by no missing distal tip cells (in males or hermaphrodites), no extra anchor cells (in hermaphrodites), and no extra linker cells (in males) | ||||
| EQ_annotations | Anatomy_term | WBbt:0006865 | PATO:0000460 | |||
| Remark | (Table 4) cwn-2 RNAi. Authors report generating dsRNA by RT-PCR to the 5' end of the gene and that clones contained at least 650bp of exon sequence. First 650bp of coding region of cDNA used for curation. | |||||
| Method | RNAi |
