WormBase Tree Display for RNAi: WBRNAi00097135

WBRNAi00097135 Homol: Homol_homol: T27F2:RNAi
  Sequence_info: DNA_text: ATGGCACCCGGGACCAAAAAAAAGTCGGATATGGCAAAATTCACATTCTACAAAGATCGCTTGATGACATTCAAAAATTTCGAATATGATAGAGACCCGGATGCAAAATGCACGTCTCAAGCGGTTGCTCAAGCCGGATTTTACTGCACCGGTCCTCAGTCTGGCAAATGTGCATTTTGCAACAAGGAACTTGATTTTGACCCAGAAGACGATCCGTGGTACGAGCACACGAAACGTGATGAACCGTGCGAGTTTGTACGGATTGGAAAGCTCGATGACTCGGAATTAACTATTAACGATACCGTTCGTCTCTCACAAACCGCCATGATTATGACTAAACTCTTTGAGCATGAGATGATGATAAATAATTTGTCTAATCATTCTTCTTCTGATGCTCTCTTCGATCAGCTGAAAAAAGTACCGAACACAGCATCGACAACAAAATCTAACAGCCGCCGCGGCAAATAA
  Experiment: Laboratory: WS
    Date: 22 Feb 1999 00:00:00
    Treatment: Young adult N2 worms were injected in both gonads with dsRNA and observed at least 15 hours later. Individual embryos were obtained by dissecting worms in a concave slide and mouthpipetting released embryos onto a 4% agar pad in M9 buffer and the embryos observed using a Zeiss Axioplan microscope.
    Delivered_by: Injection
  Inhibits: Predicted_gene: T27F2.3 Inferred_automatically: RNAi_primary
    Gene: WBGene00000249 Inferred_automatically: RNAi_primary
    Transcript: T27F2.3.1 Inferred_automatically: RNAi_primary
      T27F2.3.2 Inferred_automatically: RNAi_primary
  Species: Caenorhabditis elegans
  Reference: WBPaper00003470
  Phenotype: WBPhenotype:0000777 Remark: bir-1 RNAi embryos were multinucleate and over 75% of embryos failed to form more than two cells. Whereas cytokinesis initiated normally, and the cleavage furrow progressed to a great extent, cytokinesis failed to complete and the cleavage furrow subsequently regressed. Following the regression of the cleavage furrow, the nuclei entered a new cell cycle, resulting in highly multinucleate zygotes. The bir-1(RNAi) embryos were also defective in the extrusion of the polar body.
    WBPhenotype:0000867 Remark: bir-1 RNAi embryos were multinucleate and over 75% of embryos failed to form more than two cells. Whereas cytokinesis initiated normally, and the cleavage furrow progressed to a great extent, cytokinesis failed to complete and the cleavage furrow subsequently regressed. Following the regression of the cleavage furrow, the nuclei entered a new cell cycle, resulting in highly multinucleate zygotes. The bir-1(RNAi) embryos were also defective in the extrusion of the polar body.
    WBPhenotype:0001078 Remark: bir-1 RNAi embryos were multinucleate and over 75% of embryos failed to form more than two cells. Whereas cytokinesis initiated normally, and the cleavage furrow progressed to a great extent, cytokinesis failed to complete and the cleavage furrow subsequently regressed. Following the regression of the cleavage furrow, the nuclei entered a new cell cycle, resulting in highly multinucleate zygotes. The bir-1(RNAi) embryos were also defective in the extrusion of the polar body.
    WBPhenotype:0001143 Remark: bir-1 RNAi embryos were multinucleate and over 75% of embryos failed to form more than two cells. Whereas cytokinesis initiated normally, and the cleavage furrow progressed to a great extent, cytokinesis failed to complete and the cleavage furrow subsequently regressed. Following the regression of the cleavage furrow, the nuclei entered a new cell cycle, resulting in highly multinucleate zygotes. The bir-1(RNAi) embryos were also defective in the extrusion of the polar body.
    WBPhenotype:0001886 Remark: bir-1 RNAi embryos were multinucleate and over 75% of embryos failed to form more than two cells. Whereas cytokinesis initiated normally, and the cleavage furrow progressed to a great extent, cytokinesis failed to complete and the cleavage furrow subsequently regressed. Following the regression of the cleavage furrow, the nuclei entered a new cell cycle, resulting in highly multinucleate zygotes. The bir-1(RNAi) embryos were also defective in the extrusion of the polar body.
  Remark: (Figure 5) bir-1 RNAi. Exact sequence used for RNAi not stated by authors, spliced coding region sequence of gene used for curation.
  Method: RNAi