WormBase Tree Display for RNAi: WBRNAi00092476
expand all nodes | collapse all nodes | view schema
| WBRNAi00092476 | Homol | Homol_homol | W10C8:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | ATGATGGCCGACGAAGAGCTCGGCGATGAGGTGAAGGTGTTCCGTCGGGATGAGGATGCTGACGATGATCCAATGATTAGTGGTGAAACGTCAGAACAACAGTTAGCCGATGATAAAAAAGAAGCTGTAATGGAAGCAGAATTAGACGGTGCCGGTCGAAATCCATCGATTGATGTGTTAAAAAGTGCATTTCCAAAAGTCGAACCAATGTCACCATCGTTTCCCGGTTTAATGTCACACTTCAGTCCTGGATACTCGGCAGCTGCTTTACCCATGTTTATGCCTCTATTTATGAATCCATACGCAGCAGCACTACGATCACCAAGCCTGATGTTTCCAATGGGAGCAATGAGCCCCACATTTCCAATGTTCCCGCCAAGTCCTGTCTATGGAGCAGCAATCGCTGCGGCAGCCGCCAAACAACACTTTGAGAATATGGCTCCACTGAACATGCGAGCCGGTCATCCAATGAATCAGATGGGAATGCCACCATACATGCATCCATCATCAATGGCTCCACAGAATGTCGATCGAAGGGCTCAAGGAGGTGGAAAAGCGAAGAAGGATGATCATGTGAAGAAGCCATTAAACGCGTTCATGTGGTTTATGAAGGAAAATCGAAAAGCACTGCTGGAAGAGATTGGAAATAATGAGAAACAGAGTGCAGAGTTGAATAAAGAGCTTGGAAAGAGGTGGCATGATTTGTCGAAGGAAGAACAGGCGAAATATTTTGAAATGGCAAAGAAGGATAAGGAAACACACAAGGAACGGTATCCGGAGTGGTCGGCGCGGGAAAATTATGCGGTTAATAAGAAAAAGACGAAGAAACGAAGGGATAAGAGTATTCCATCGGAGAACAACGATCAGAAGAAGTGCCGAGCCAGATTCGGAGTTAACAACACAGAAATGTGGTGTAAATTCTGCAAGCGGAAGAAGAAGTGCGAGTACGCAACTGATCGTTCGGGCGGTTCCGATATAACTGACAGTCAGGATGGACGAGGTACAAGTGGTGCGTATAGCAGTAGCTCGGAGAGCCCATCACCAAAGGCAAACGCTGGAATTGCACTGACCACACAGCAGCAGCAAGCAGCAATGATGCATACGATGTTGATGCAAATGCGTCTAGGATCGACGACGGGAGCATCGACGCACGTTCCATCACCACTGGCGTCCTCGTCGGCAGGCAGGAGTCCGCTGGATGCGAACGCGTCGGATTCGGAATCTGATGTTGAGGAGGAGGAAGACGAGCAGATTGATCCGACGGTTATGCAGCAGACACATGATATGCTTATGCAGGAATCGATGTGTACTATTTAA | |||
| Experiment | Laboratory | JM | |||
| Date | 02 Oct 1998 00:00:00 | ||||
| Delivered_by | Injection | ||||
| Inhibits | Predicted_gene | W10C8.2 | Inferred_automatically | RNAi_primary | |
| Gene | WBGene00004077 | Inferred_automatically | RNAi_primary | ||
| Transcript | W10C8.2.1 | Inferred_automatically | RNAi_primary | ||
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00003331 | ||||
| Phenotype | WBPhenotype:0000124 | Remark | Injection of pop-1 dsRNA results in the production of arrested embryos with approximately double the wild-type number of gut cells. Almost all of these embryos (299/318 = 94%) fail to express transgenic LacZ (under the control of a modified ges-1 promoter) in the gut (unlike wild type embryos). Although the endogenous ges-1 gene is still expressed, the anterior-to-posterior gradient of endogenous ges-1 activity observed in wild-type embryos is now abolished. | ||
| WBPhenotype:0000867 | Remark | Injection of pop-1 dsRNA results in the production of arrested embryos with approximately double the wild-type number of gut cells. Almost all of these embryos (299/318 = 94%) fail to express transgenic LacZ (under the control of a modified ges-1 promoter) in the gut (unlike wild type embryos). Although the endogenous ges-1 gene is still expressed, the anterior-to-posterior gradient of endogenous ges-1 activity observed in wild-type embryos is now abolished. | |||
| WBPhenotype:0001375 | Remark | Injection of pop-1 dsRNA results in the production of arrested embryos with approximately double the wild-type number of gut cells. Almost all of these embryos (299/318 = 94%) fail to express transgenic LacZ (under the control of a modified ges-1 promoter) in the gut (unlike wild type embryos). Although the endogenous ges-1 gene is still expressed, the anterior-to-posterior gradient of endogenous ges-1 activity observed in wild-type embryos is now abolished. | |||
| WBPhenotype:0001636 | Remark | Injection of pop-1 dsRNA results in the production of arrested embryos with approximately double the wild-type number of gut cells. Almost all of these embryos (299/318 = 94%) fail to express transgenic LacZ (under the control of a modified ges-1 promoter) in the gut (unlike wild type embryos). Although the endogenous ges-1 gene is still expressed, the anterior-to-posterior gradient of endogenous ges-1 activity observed in wild-type embryos is now abolished. | |||
| Remark | (Text, Figure 9) pop-1 RNAi | ||||
| Method | RNAi |
