WormBase Tree Display for RNAi: WBRNAi00088422

WBRNAi00088422 Homol: Homol_homol: CHROMOSOME_IV:RNAi
  Sequence_info: DNA_text: ATGGATTCGGTTAAGCACACAACCGAAATTATTGTCGACTTGACAAAAATGCACTATCACATGATAAATGATAGACTTTCTCGGTATGATCCGGTTGTTCTAGTGTTGGCCGCTTTTGGGGGTACCCTTGTCTATACAAAAGTCGTCCATTTGTACCGAAAAAGCGAGGATCCAATTTTGAAACGCATGGGAGCTTATGTATTCTCACTTCTTCGAAAACTTCCAGCTGTTCGGGATAAAATCGAAAAAGAGCTGGCTGCTGAGAAGCCAAAGCTTATTGAATCGATTCATAAGGATGATAAGGACAAGCAATTCATTTCCACTCTTCCCATCGCTCCATTATCTCAGGACTCAATTATGGAACTGGCGAAAAAATATGAGGATTACAACACATTTAACATTGACGGAGGACGAGTATCTGGAGCGGTTTATACTGATCGTCATGCTGAACACATTAATTTGCTTGGAAAGATTTACGAAAAGTATGCGTTCTCGAATCCCCTCCACCCTGACGTCTTTCCGGGAGCTCGTAAAATGGAGGCAGAACTTATTCGAATGGTTCTGAACCTGTATAATGGACCAGAAGATTCTAGTGGAAGTGTAACTTCTGGTGGTACTGAAAGTATTATTATGGCATGCTTTTCGTATCGAAATCGTGCACACTCTCTTGGCATTGAACATCCAGTTATTTTGGCATGTAAAACAGCTCACGCGGCATTTGATAAGGCCGCCCATCTATGCGGAATGCGTCTTCGCCACGTTCCAGTTGATTCGGATAATCGTGTCGATTTAAAAGAAATGGAGAGACTAATTGATTCGAATGTTTGTATGTTGGTTGGCTCAGCGCCTAACTTCCCATCAGGCACAATTGATCCAATTCCGGAAATTGCTAAGCTCGGCAAAAAGTATGGAATCCCGGTCCACGTGGACGCATGTCTTGGTGGATTCATGATTCCATTTATGAATGACGCCGGATACCTGATTCCTGTATTCGATTTCAGAAATCCCGGTGTTACATCTATTTCGTGTGATACTCATAAGTACGGATGCACACCGAAAGGTTCATCGATTGTCATGTATCGTTCCAAGGAACTTCATCACTTCCAGTATTTCTCGGTTGCCGATTGGTGTGGAGGCATCTATGCCACCCCGACTATTGCAGGATCCCGAGCTGGAGCCAACACTGCCGTCGCCTGGGCCACACTTTTATCCTTCGGTCGAGACGAATATGTTCGAAGATGTGCTCAAATTGTGAAGCATACACGAATGCTGGCCGAGAAAATTGAGAAAATCAAATGGATCAAGCCTTATGGAAAATCGGATGTTTCATTGGTGGCGTTCTCCGGAAATGGTGTGAATATCTACGAAGTTTCTGACAAAATGATGAAGCTCGGATGGAATTTGAACACTCTGCAGAATCCAGCGGCAATCCACATTTGTTTGACAATCAATCAAGCGAACGAGGAAGTTGTGAATGCGTTCGCCGTCGACCTTGAGAAGATTTGTGAAGAACTCGCTGCAAAAGGTGAACAAAAAGCTGACAGTGGAATGGCTGCGATGTATGGAATGGCTGCGCAAGTACCAAAATCAGTAGTGGACGAGGTTATCGCTCTGTACATTGACGCAACTTATTCAGCTCCACCTTCAACTTCTAATTAA
  Experiment: Laboratory: PS
    Date: 20 Jun 2003 00:00:00
    Delivered_by: Injection
  Inhibits: Predicted_gene: Y66H1B.4 Inferred_automatically: RNAi_primary
    Gene: WBGene00004981 Inferred_automatically: RNAi_primary
    Transcript: Y66H1B.4.1 Inferred_automatically: RNAi_primary
  Species: Caenorhabditis elegans
  Reference: WBPaper00005941
  Phenotype: WBPhenotype:0000006 Remark: For SPL dsRNA-injected worms, all eggs laid after ~12 h post-injection demonstrated abnormalities, although these ranged broadly in severity from worms that did not develop beyond L1 or L2 stages to worms that developed to adulthood and demonstrated defects of adult structures. Compared with control F1s, animals inheriting spl-1 dsRNA developed slowly, moved sluggishly, and were thin, pale, and starved in appearance. The adults were smaller than controls and did not pump food actively. The treated animals reached adulthood 24-48 h later than controls. Adult hermaphrodites that inherited spl-1 dsRNA were markedly different from controls especially in the gonad and uterus. Although control animals had abundant nuclei in the distal gonad and a row of developing oocytes in the proximal gonad, affected hermaphrodites had poorly developed distal gonads with fewer nuclei. Control adults had embryos of progressive stages of development in the uterus, whereas the number of developing oocytes in the proximal gonad of affected hermaphrodites was significantly reduced. The embryos in the uterus of affected progeny were also morphologically abnormal. Those near the vulva were at late developmental stages, indicating a defect in egg laying. There was not a uniform progression of developmental stages in adjacent embryos suggesting a defect in ovulation or cell division. Embryonic and larval semi-lethality was observed, and some premature death of adults was also noted. None of these effects were found in worms that inherited B0222.4 dsRNA, which were similar in growth, appearance, and reproduction to uninjected worms. Furthermore, no synergistic effects were observed when B0222.4 and spl-1 dsRNA were injected together.
    WBPhenotype:0000019 Remark: For SPL dsRNA-injected worms, all eggs laid after ~12 h post-injection demonstrated abnormalities, although these ranged broadly in severity from worms that did not develop beyond L1 or L2 stages to worms that developed to adulthood and demonstrated defects of adult structures. Compared with control F1s, animals inheriting spl-1 dsRNA developed slowly, moved sluggishly, and were thin, pale, and starved in appearance. The adults were smaller than controls and did not pump food actively. The treated animals reached adulthood 24-48 h later than controls. Adult hermaphrodites that inherited spl-1 dsRNA were markedly different from controls especially in the gonad and uterus. Although control animals had abundant nuclei in the distal gonad and a row of developing oocytes in the proximal gonad, affected hermaphrodites had poorly developed distal gonads with fewer nuclei. Control adults had embryos of progressive stages of development in the uterus, whereas the number of developing oocytes in the proximal gonad of affected hermaphrodites was significantly reduced. The embryos in the uterus of affected progeny were also morphologically abnormal. Those near the vulva were at late developmental stages, indicating a defect in egg laying. There was not a uniform progression of developmental stages in adjacent embryos suggesting a defect in ovulation or cell division. Embryonic and larval semi-lethality was observed, and some premature death of adults was also noted. None of these effects were found in worms that inherited B0222.4 dsRNA, which were similar in growth, appearance, and reproduction to uninjected worms. Furthermore, no synergistic effects were observed when B0222.4 and spl-1 dsRNA were injected together.
    WBPhenotype:0000062 Remark: For SPL dsRNA-injected worms, all eggs laid after ~12 h post-injection demonstrated abnormalities, although these ranged broadly in severity from worms that did not develop beyond L1 or L2 stages to worms that developed to adulthood and demonstrated defects of adult structures. Compared with control F1s, animals inheriting spl-1 dsRNA developed slowly, moved sluggishly, and were thin, pale, and starved in appearance. The adults were smaller than controls and did not pump food actively. The treated animals reached adulthood 24-48 h later than controls. Adult hermaphrodites that inherited spl-1 dsRNA were markedly different from controls especially in the gonad and uterus. Although control animals had abundant nuclei in the distal gonad and a row of developing oocytes in the proximal gonad, affected hermaphrodites had poorly developed distal gonads with fewer nuclei. Control adults had embryos of progressive stages of development in the uterus, whereas the number of developing oocytes in the proximal gonad of affected hermaphrodites was significantly reduced. The embryos in the uterus of affected progeny were also morphologically abnormal. Those near the vulva were at late developmental stages, indicating a defect in egg laying. There was not a uniform progression of developmental stages in adjacent embryos suggesting a defect in ovulation or cell division. Embryonic and larval semi-lethality was observed, and some premature death of adults was also noted. None of these effects were found in worms that inherited B0222.4 dsRNA, which were similar in growth, appearance, and reproduction to uninjected worms. Furthermore, no synergistic effects were observed when B0222.4 and spl-1 dsRNA were injected together.
    WBPhenotype:0000520 Remark: For SPL dsRNA-injected worms, all eggs laid after ~12 h post-injection demonstrated abnormalities, although these ranged broadly in severity from worms that did not develop beyond L1 or L2 stages to worms that developed to adulthood and demonstrated defects of adult structures. Compared with control F1s, animals inheriting spl-1 dsRNA developed slowly, moved sluggishly, and were thin, pale, and starved in appearance. The adults were smaller than controls and did not pump food actively. The treated animals reached adulthood 24-48 h later than controls. Adult hermaphrodites that inherited spl-1 dsRNA were markedly different from controls especially in the gonad and uterus. Although control animals had abundant nuclei in the distal gonad and a row of developing oocytes in the proximal gonad, affected hermaphrodites had poorly developed distal gonads with fewer nuclei. Control adults had embryos of progressive stages of development in the uterus, whereas the number of developing oocytes in the proximal gonad of affected hermaphrodites was significantly reduced. The embryos in the uterus of affected progeny were also morphologically abnormal. Those near the vulva were at late developmental stages, indicating a defect in egg laying. There was not a uniform progression of developmental stages in adjacent embryos suggesting a defect in ovulation or cell division. Embryonic and larval semi-lethality was observed, and some premature death of adults was also noted. None of these effects were found in worms that inherited B0222.4 dsRNA, which were similar in growth, appearance, and reproduction to uninjected worms. Furthermore, no synergistic effects were observed when B0222.4 and spl-1 dsRNA were injected together.
    WBPhenotype:0000691 Remark: For SPL dsRNA-injected worms, all eggs laid after ~12 h post-injection demonstrated abnormalities, although these ranged broadly in severity from worms that did not develop beyond L1 or L2 stages to worms that developed to adulthood and demonstrated defects of adult structures. Compared with control F1s, animals inheriting spl-1 dsRNA developed slowly, moved sluggishly, and were thin, pale, and starved in appearance. The adults were smaller than controls and did not pump food actively. The treated animals reached adulthood 24-48 h later than controls. Adult hermaphrodites that inherited spl-1 dsRNA were markedly different from controls especially in the gonad and uterus. Although control animals had abundant nuclei in the distal gonad and a row of developing oocytes in the proximal gonad, affected hermaphrodites had poorly developed distal gonads with fewer nuclei. Control adults had embryos of progressive stages of development in the uterus, whereas the number of developing oocytes in the proximal gonad of affected hermaphrodites was significantly reduced. The embryos in the uterus of affected progeny were also morphologically abnormal. Those near the vulva were at late developmental stages, indicating a defect in egg laying. There was not a uniform progression of developmental stages in adjacent embryos suggesting a defect in ovulation or cell division. Embryonic and larval semi-lethality was observed, and some premature death of adults was also noted. None of these effects were found in worms that inherited B0222.4 dsRNA, which were similar in growth, appearance, and reproduction to uninjected worms. Furthermore, no synergistic effects were observed when B0222.4 and spl-1 dsRNA were injected together.
    WBPhenotype:0000749 Remark: For SPL dsRNA-injected worms, all eggs laid after ~12 h post-injection demonstrated abnormalities, although these ranged broadly in severity from worms that did not develop beyond L1 or L2 stages to worms that developed to adulthood and demonstrated defects of adult structures. Compared with control F1s, animals inheriting spl-1 dsRNA developed slowly, moved sluggishly, and were thin, pale, and starved in appearance. The adults were smaller than controls and did not pump food actively. The treated animals reached adulthood 24-48 h later than controls. Adult hermaphrodites that inherited spl-1 dsRNA were markedly different from controls especially in the gonad and uterus. Although control animals had abundant nuclei in the distal gonad and a row of developing oocytes in the proximal gonad, affected hermaphrodites had poorly developed distal gonads with fewer nuclei. Control adults had embryos of progressive stages of development in the uterus, whereas the number of developing oocytes in the proximal gonad of affected hermaphrodites was significantly reduced. The embryos in the uterus of affected progeny were also morphologically abnormal. Those near the vulva were at late developmental stages, indicating a defect in egg laying. There was not a uniform progression of developmental stages in adjacent embryos suggesting a defect in ovulation or cell division. Embryonic and larval semi-lethality was observed, and some premature death of adults was also noted. None of these effects were found in worms that inherited B0222.4 dsRNA, which were similar in growth, appearance, and reproduction to uninjected worms. Furthermore, no synergistic effects were observed when B0222.4 and spl-1 dsRNA were injected together.
    WBPhenotype:0000848 Remark: For SPL dsRNA-injected worms, all eggs laid after ~12 h post-injection demonstrated abnormalities, although these ranged broadly in severity from worms that did not develop beyond L1 or L2 stages to worms that developed to adulthood and demonstrated defects of adult structures. Compared with control F1s, animals inheriting spl-1 dsRNA developed slowly, moved sluggishly, and were thin, pale, and starved in appearance. The adults were smaller than controls and did not pump food actively. The treated animals reached adulthood 24-48 h later than controls. Adult hermaphrodites that inherited spl-1 dsRNA were markedly different from controls especially in the gonad and uterus. Although control animals had abundant nuclei in the distal gonad and a row of developing oocytes in the proximal gonad, affected hermaphrodites had poorly developed distal gonads with fewer nuclei. Control adults had embryos of progressive stages of development in the uterus, whereas the number of developing oocytes in the proximal gonad of affected hermaphrodites was significantly reduced. The embryos in the uterus of affected progeny were also morphologically abnormal. Those near the vulva were at late developmental stages, indicating a defect in egg laying. There was not a uniform progression of developmental stages in adjacent embryos suggesting a defect in ovulation or cell division. Embryonic and larval semi-lethality was observed, and some premature death of adults was also noted. None of these effects were found in worms that inherited B0222.4 dsRNA, which were similar in growth, appearance, and reproduction to uninjected worms. Furthermore, no synergistic effects were observed when B0222.4 and spl-1 dsRNA were injected together.
    WBPhenotype:0001944 Remark: For SPL dsRNA-injected worms, all eggs laid after ~12 h post-injection demonstrated abnormalities, although these ranged broadly in severity from worms that did not develop beyond L1 or L2 stages to worms that developed to adulthood and demonstrated defects of adult structures. Compared with control F1s, animals inheriting spl-1 dsRNA developed slowly, moved sluggishly, and were thin, pale, and starved in appearance. The adults were smaller than controls and did not pump food actively. The treated animals reached adulthood 24-48 h later than controls. Adult hermaphrodites that inherited spl-1 dsRNA were markedly different from controls especially in the gonad and uterus. Although control animals had abundant nuclei in the distal gonad and a row of developing oocytes in the proximal gonad, affected hermaphrodites had poorly developed distal gonads with fewer nuclei. Control adults had embryos of progressive stages of development in the uterus, whereas the number of developing oocytes in the proximal gonad of affected hermaphrodites was significantly reduced. The embryos in the uterus of affected progeny were also morphologically abnormal. Those near the vulva were at late developmental stages, indicating a defect in egg laying. There was not a uniform progression of developmental stages in adjacent embryos suggesting a defect in ovulation or cell division. Embryonic and larval semi-lethality was observed, and some premature death of adults was also noted. None of these effects were found in worms that inherited B0222.4 dsRNA, which were similar in growth, appearance, and reproduction to uninjected worms. Furthermore, no synergistic effects were observed when B0222.4 and spl-1 dsRNA were injected together.
  Remark: paper remark: Exact sequence used for RNAi not stated by authors, spliced coding region sequence of gene used for curation.
  Method: RNAi