WormBase Tree Display for RNAi: WBRNAi00087594

WBRNAi00087594 Homol: Homol_homol: Y39G8C:RNAi
  Sequence_info: DNA_text: ggtttcttcgacgcctaacaagagactttctccagtttacaagccatctccagtcccaaagaatactccaagaactacttcatcatcaagcaaaaccactatcaacacaactactactcgcattccatcaactccccggaggattacctcagtgcccgggttgatcacagacttcacgccaagcttctccacattcggaagcgatcgccccggcgctacaccgccaagaaaatcgatttacacgtcgaaagtgtccaaagttcttcacgacttgggaaacactaccggagaagaggatgatgatgacgagtttgaaggtcaagagacgagtagaatcatctacaagacagaagaaccctcgcggcggggcattgtgaagaacgcgtggaacaaggtgctcggctatggtttcgatgcgtccaagaatccaggagacagctatgatcttcgcgccggtgcctccagaatccgtgtgcagaagaatccgagaaccgggaaggtgactgtgaagcagacgaatattttcaacgaggcgatttatttcgcgctctatgtgattttaattttgttcgtcgtgcttggaatcgcctacgcgctgacaacaacgcatcgcccgaaaactgcggatttctcgggttattggggagttttgaaggcggccggccgagattcgctcaatttcttctacaattacgcgattcttccagtcgtttca
  Experiment: Date: 15 Apr 2003 00:00:00
    Strain: WBStrain00000001
    Delivered_by: Injection
  Inhibits: Predicted_gene: W01G7.5 Inferred_automatically: RNAi_primary
    Gene: WBGene00002275 Inferred_automatically: RNAi_primary
    Transcript: W01G7.5.1 Inferred_automatically: RNAi_primary
  Species: Caenorhabditis elegans
  Reference: WBPaper00005828
  Phenotype: WBPhenotype:0000050 Remark: Even after injecting high concentrations of lem-2 dsRNA, residual (slightly punctate) nuclear envelope staining of Ce-MAN1 was still detectable in lem-2(RNAi) embryos. Reduced Ce-MAN1 had no effect on the localization of Ce-lamin, Ce-emerin, or an unrelated nuclear membrane protein, UNC-84. Quantitative analysis revealed a 6- to 10-fold decrease in the fluorescence intensity of Ce-MAN1 in lem-2(RNAi) embryos, relative to control embryos. Nonetheless, this 8590% reduction of Ce-MAN1 pro-tein caused 15% embryonic lethality (n = 200), with most dead embryos arresting after the 2-fold stage. DAPI staining revealed that in a few (<1%) early lem-2(RNAi) embryos, pairs of daughter cells were connected by a thin bridge of chromatin. Indirect immunofluorescence staining suggested that Ce-lamin localized correctly around the chromatin masses, except at the sites of chromatin bridges. However, the majority of lem-2(RNAi) embryos had normal mitosis and developed into normal fertile adults.
    WBPhenotype:0000773
  Remark: dsRNA corresponding to Ce-MAN1 residues 147 to 385 was used. The low-penetrance chromosome segregation defect was unlikely to be due to mislocalization of other nuclear envelope proteins, because no effects was observed on Ce-lamin, Ce-emerin, or UNC84. Instead, the embryonic lethality and chromosome segregation defects seen in lem-2(RNAi) embryos, which retained 1015% Ce-MAN1 protein, suggested that Ce-MAN1 might be an essential component of the nuclear envelope, with roles in cell division or early development.
  Method: RNAi