WormBase Tree Display for RNAi: WBRNAi00087553
expand all nodes | collapse all nodes | view schema
| WBRNAi00087553 | Homol | Homol_homol | ZC155:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | atgacttccccatacgctacaatcgtcgacgctagagagttcaatgctccgatgttcgctgagaagatcgaccgtgctcttcgtgccggagagaaggacgctgttgtcaacgtcatcacctcgatctccaacgctcagcgccagcagctccgcgagccatacaagctcaagtacggaaaggacatcatccaggctcttgacaagaagttctctggagatctcgagaaggccatcttcgctctcatggaaactccattggattatgatgtgaagcagcttaaggctgccatgaagggattgggaactgacgaggctgtgctcatcgagattttgtgctccagaactgttgatcaactccgcgccattcgtgtgacctacgagaaggagtatggaaaggctttggaagctgacatcgctggagatacttctggagaattccgtgatcttttggtcagcttggtcactggatccaaagacggatctcatgataccaacgacgctcaggccaaggatgatgctgttcgcctgttcgccgacggaaaagccaagcttgccaagaaggacggaacacacttccttcacatcctcgccactcaaaatcaataccagctccgcaaggtcttcgcctacttccaggaactcgctggtggctctatcgagaaaagcatcgagaaggagttttccggagatctccagaaatcctacctcaccattgtccgtgccgcttccgacaagcagaagttcttcgctcagcagctccacgcttccatgaaaggactcggaactcgcgataacgacttgatccgtgtcatcgtcactcgttccgaagtcgacttggagctcatcaaggccgaattccaagagctctactctaagagcttggccgacacagtgaagggagacacttctggagcctaccgtgacgctctgctctccatcatcaatggaaaccacgctactgcccactag | |||
| Experiment | Date | 01 Apr 2003 00:00:00 | |||
| Strain | WBStrain00000001 | ||||
| Delivered_by | Injection | ||||
| Inhibits | Predicted_gene | ZC155.1 | Inferred_automatically | RNAi_primary | |
| Gene | WBGene00003588 | Inferred_automatically | RNAi_primary | ||
| Transcript | ZC155.1.1 | Inferred_automatically | RNAi_primary | ||
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00005874 | ||||
| Phenotype | WBPhenotype:0000885 | Remark | No detectable cell corpses were seen in the wild-type or in the control siRNA-injected larvae. In contrast, significant numbers of unengulfed cell corpses were apparent in the pharynx and head of the nex-1-silenced worms. Scoring the unengulfed pharyngeal corpses from the pooled nex-1-silenced larvae revealed an average of 0.9 per animal (56 corpses in 62 animals). | ||
| Remark | paper remark: Exact sequence used for RNAi not stated by authors, spliced coding region sequence of gene used for curation. | ||||
| Method | RNAi |
