WormBase Tree Display for RNAi: WBRNAi00087542

WBRNAi00087542 Homol: Homol_homol: T27F2:RNAi
  Sequence_info: DNA_text: agcgcgaaattcgtcagtgcgacgcgagctacatttattgatttttcaacattttattcgataaatgttttctgagatttgtttttcatttatatttaaatacacactgaaaaaataaaaccacgtggcgtggatgcgcgaatttcatgaaattaaacttcattttcgaaatctattaaaatacgccacgaagttttattattttcaatgtaagtctcgttttatcttttccttttatcaatcgatttcaacgctttcaacttatttttttggaattgtggtttttagttcaaatcttcttaactgtatttcgaatttttaatctctacctgttcgaaatagattcctcaagattaagatacctagttgtttttcattgatttcagaaaatggcacccgggaccaaaaaaaagtcggatatggcaaaattcacattctacaaagatcgcttgatgacattcaaaaatttcgaatatgatagagacccggatgcaaaatgcacgtctcaagcggtttgtccattttcgtgttttaaataaaattattcttgttttaggttgctcaagccggattttactgcaccggtcctcagtctggcaaatgtgcattttgcaacaaggaacttgattttgacccagaagacgatccgtggtacgagcacacgaaacgtgatgaaccgtgcgagtttgtacggattggaaagctcgatgactcggaattaactattaacgataccgttcgtctctcacaaaccgccatgattatgactaaactctttgagcatgagatgatgataaataatttgtctaatcattcttcttctgatgctctcttcgatcagctgaaaaaagtaccgaacacagcatcgacaacaaaatctaacagccgccgcggcaaataatttttctacatcacttactgcaacttatccaattattgatttgatctcatatactcgatttaatcactgttcaataaacacttaattcattatttta
  Experiment: Date: 29 Apr 2003 00:00:00
    Delivered_by: Bacterial_feeding
  Inhibits: Predicted_gene: T27F2.3 Inferred_automatically: RNAi_primary
    Gene: WBGene00000249 Inferred_automatically: RNAi_primary
    Transcript: T27F2.3.1 Inferred_automatically: RNAi_primary
      T27F2.3.2 Inferred_automatically: RNAi_primary
  Species: Caenorhabditis elegans
  Reference: WBPaper00005853
  Phenotype: WBPhenotype:0000006 Remark: Several developmental defects were observed in treated animals. bir-1 RNAi resulted in an egg-laying (Egl) phenotype in 80% of young adult animals (n = 3,408) that became nearly fully penetrant in older adults. bir-1 RNAi-treated hermaphrodites laid 50% the normal number of embryos compared with control animals (n = 20 for each group). The vulva and egg-laying muscles were formed normally suggesting a neuronal defect as the cause of the Egl phenotype in these bir-1 RNAi adults. A short and fat dumpy (Dpy) phenotype was also observed in a fraction (n = 992, 29%) of larvae at L3 and L4 stage and young adult animals when L1 larvae were treated with bir-1 RNAi. If larvae L2 were treated with bir-1 RNAi, the effect was less pronounced and visible later during adulthood (n = 208, 26%). In animals showing the pronounced Dpy phenotype the movement was also affected. The worms showed slow uncoordinated (Unc) movement. Non-Dpy animals also had movement defects after bir-1 RNAi that consisted of larger-than-normal amplitudes of body curvature. There was also a germ-line defect in 20% of bir-1 RNAi-treated animals (n = 680). Wild-type adult hermaphrodites have two germ-line-filled gonad arms arranged symmetrically above the vulva. During the L2 to L4 larval stages, the gonads form by elongation of the germ-line and somatic gonad primordium. At the leading edge of each elongating gonad arm is a distal tip cell (DTC), the migration path of which dictates the shape of the gonad. After the L3 molt, the DTCs U-turn and continue to grow in opposite directions, resulting in two symmetrically reflexed gonads. The gonads in bir-1 RNAi-treated animals often made multiple turns (usually three) during elongation. The elongation defect appeared to be stochastic, and the growth of only one gonad arm was affected in any given animal. Cells composing egg laying and anal muscles were normally developed and observed on transgenic lines expressing CeSKIP::gfp. Interestingly, the DTCs did not have defects in cell division as might be expected from the known BIR-1 function in cytokinesis, suggesting that only a DTC migration defect was responsible for the abnormal gonads. There were two additional defects observed in bir-1 RNAi-treated animals that were present less frequently. In 10% (n = 344) of bir-1 RNAi-treated animals, there was an intestinal defect consisting of gut distention. A similar percentage of animals had a protruding vulva (Pvul) phenotype. bir-1 RNAi negatives affects transgene expression and endogenous gene expression.
      Penetrance: Complete
      EQ_annotations: Anatomy_term: WBbt:0006865 PATO:0000460
    WBPhenotype:0000134
    WBPhenotype:0000188 Penetrance: Range: 20
    WBPhenotype:0000583 Penetrance: Range: 29
    WBPhenotype:0000643 Penetrance: Range: 29
    WBPhenotype:0000697 Penetrance: Range: 10
    WBPhenotype:0000710 Penetrance: Range: 10
    WBPhenotype:0001278
  Method: RNAi