WormBase Tree Display for RNAi: WBRNAi00087522
expand all nodes | collapse all nodes | view schema
| WBRNAi00087522 | Homol | Homol_homol | T03F1:RNAi | ||
|---|---|---|---|---|---|
| W09C3:RNAi | |||||
| Sequence_info | DNA_text | atgacagcgacaatcgatgtcgataacttgatgagccgtttgctcaatgtcggcatgtccggtggaagactgacaacttctgtcaacgagcaggaactccagacgtgctgcgctgtggccaagtcggtgttcgcctcccaagcatcactcctggaggttgagccgccgatcatcgtgtgcggagacatccacggacagtactcggaccttttgcgcatctttgacaagaatggattcccaccggatatcaattttttgttcctgggagattatgtggatcgtggaagacagaatattgagacaatctgtttgatgttctgcttcaagatcaagtatccggagaacttcttcatgcttcgtggaaaccacgagtgcccagccatcaatcgtgtctatgggttctacgaggagtgcaaccgtcgttacaagtcgactcgtctctggtcaatcttccaggacacgttcaactggatgcctctctgtggactcattggttcccgcatcctctgcatgcatggtggcctctccccacacctccaaactcttgatcaactccgtcaacttcctcgccctcaggatccaccaaatccatcgattggaatcgacttgttgtgggctgatccggatcaatgggtgaagggatggcaggcaaatactcgtggagtctcttatgtctttggacaggatgttgttgctgacgtttgctcgagacttgacatcgacttggttgctcgtgcacatcaagtcgttcaagacggctacgagttcttcgcctccaagaagatggtcaccattttctcggcgcctcactactgcggacagtttgacaattcggctgcaacaatgaaggtcgatgagaacatggtctgtactttcgtcatgtacaagccaactccgaagtctcttcgtaaaggatag | |||
| Experiment | Date | 01 Mar 2003 00:00:00 | |||
| Delivered_by | Injection | ||||
| Inhibits | Predicted_gene | T03F1.5 | Inferred_automatically | RNAi_primary | |
| W09C3.6 | Inferred_automatically | RNAi_primary | |||
| Gene | WBGene00021113 | Inferred_automatically | RNAi_primary | ||
| WBGene00020187 | Inferred_automatically | RNAi_primary | |||
| Transcript | T03F1.5.3 | Inferred_automatically | RNAi_primary | ||
| T03F1.5.2 | Inferred_automatically | RNAi_primary | |||
| W09C3.6.1 | Inferred_automatically | RNAi_primary | |||
| W09C3.6.2 | Inferred_automatically | RNAi_primary | |||
| T03F1.5.1 | Inferred_automatically | RNAi_primary | |||
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00005831 | ||||
| Phenotype | WBPhenotype:0000154 | Remark | 30 ~ 40% reduction in the number of C. elegans progeny produced by treated hermaphrodites compared with negative controls. Also, no visible morphological or behavioural defects were observed in worms subjected to the RNAi treatments. | ||
| Remark | paper remark: Exact sequence used for RNAi was yk57h2, spliced coding region sequence of gene used for curation. | ||||
| Method | RNAi |
